메뉴 건너뛰기




Volumn 275, Issue 5304, 1997, Pages 1314-1317

Combinatorial control required for the specificity of yeast MAPK signaling

Author keywords

[No Author keywords available]

Indexed keywords

MITOGEN ACTIVATED PROTEIN KINASE; PHEROMONE; TRANSCRIPTION FACTOR;

EID: 0031042444     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.275.5304.1314     Document Type: Article
Times cited : (333)

References (30)
  • 3
    • 0028985079 scopus 로고
    • I. Herskowitz, Cell 80, 187 (1995); C. Wittenberg and S. I. Reed, Curr. Op. Cell. Biol. 8, 223 (1996).
    • (1995) Cell , vol.80 , pp. 187
    • Herskowitz, I.1
  • 7
    • 0025931006 scopus 로고
    • J. W. Dolan, C. Kirkman, S. Fields, Proc. Natl. Acad. Sci. U.S.A. 86, 5703 (1989); Y. L. Yuan and S. Fields, Mol. Cell. Biol. 11, 5910 (1991).
    • (1991) Mol. Cell. Biol. , vol.11 , pp. 5910
    • Yuan, Y.L.1    Fields, S.2
  • 13
    • 0029881641 scopus 로고    scopus 로고
    • in press
    • V. Gavrias, A. Andrianopoulos, C. J. Gimeno, W. E. Timberlake, Mol. Microbol. 19, 1255 (1996); H.-U. Mosch and G. R. Fink, Genetics, in press.
    • Genetics
    • Mosch, H.-U.1    Fink, G.R.2
  • 14
    • 0025783529 scopus 로고
    • T. R. Burglin, Cell 66, 11 (1991); A. Andrianopoulos and W. E. Timberlake, Plant Cell 3, 747 (1991).
    • (1991) Cell , vol.66 , pp. 11
    • Burglin, T.R.1
  • 16
    • 0028278743 scopus 로고
    • A. Andrianopoulos and W. E. Timberlake, Mol. Cell. Biol. 14, 2503 (1994); J. H. Xiao, I. Davidson, H. Matthes, J. M. Garnier, P. Chambon, Cell 65, 551 (1991); J. J. Hwang, P. Chambon, I. Davidson, EMBO J. 12, 2337 (1993).
    • (1994) Mol. Cell. Biol. , vol.14 , pp. 2503
    • Andrianopoulos, A.1    Timberlake, W.E.2
  • 17
    • 0025881086 scopus 로고
    • A. Andrianopoulos and W. E. Timberlake, Mol. Cell. Biol. 14, 2503 (1994); J. H. Xiao, I. Davidson, H. Matthes, J. M. Garnier, P. Chambon, Cell 65, 551 (1991); J. J. Hwang, P. Chambon, I. Davidson, EMBO J. 12, 2337 (1993).
    • (1991) Cell , vol.65 , pp. 551
    • Xiao, J.H.1    Davidson, I.2    Matthes, H.3    Garnier, J.M.4    Chambon, P.5
  • 18
    • 0027204754 scopus 로고
    • A. Andrianopoulos and W. E. Timberlake, Mol. Cell. Biol. 14, 2503 (1994); J. H. Xiao, I. Davidson, H. Matthes, J. M. Garnier, P. Chambon, Cell 65, 551 (1991); J. J. Hwang, P. Chambon, I. Davidson, EMBO J. 12, 2337 (1993).
    • (1993) EMBO J. , vol.12 , pp. 2337
    • Hwang, J.J.1    Chambon, P.2    Davidson, I.3
  • 19
    • 1842396969 scopus 로고    scopus 로고
    • note
    • FRE(Ty1)::lacZ was constructed by replacing the Xho I fragment of pLG669-Z (22) with a double-stranded oligonucleotide corresponding to the Ty1 FRE (CATTCTTCTGTTTTGGAAGCTGAAACG) flanked by Xho I ends. The FRE extends from positions +60 to +86 with respect to the Ty1 δ sequence, β-galactosidase (β-Gal) assays were performed as described (8) on extracts of exponentially growing cells in liquid synthetic complete medium lacking uracil for haploid cells and liquid SLAD (synthetic low-ammonia dextrose) media (23) for diploid cells.
  • 21
    • 1842360221 scopus 로고    scopus 로고
    • note
    • The FRE(TEC1)::lacZ construct was made in the same manner as the FRE(Ty1)::lacZ construct, except that an oligonucleotide corresponding to the TEC1 FRE (TGAAACACGCACATTCC) was cloned between the Xho I sites of pLG669-Z. The TEC1 FRE extends from positions -383 to -399 with respect to the start codon.
  • 22
    • 1842309117 scopus 로고    scopus 로고
    • note
    • The Eco RI-Xba I fragment containing the TEC1 promoter was cloned into YEp356R (2μ, URA3), which contains a promoterless E. coli lacZ gene. The PRE and TCS mutants were constructed by polymerase chain reaction (PCR) with the use of mutagenic primers and Pfu polymerase.
  • 23
    • 1842286273 scopus 로고    scopus 로고
    • note
    • β-Gal assays were performed on cultures grown on SLAD plates for 3 days as described (8); for the TEC1::lacZ fusion, solid medium gave more reproducible results than liquid medium.
  • 24
    • 1842322550 scopus 로고    scopus 로고
    • note
    • The Xba I-Sac I fragment containing the TEC1 coding sequence and 3′ flank was cloned in pRS306 (URA3). Wild-type and mutant promoter fragments from the TEC1::lacZ constructs were cloned up-stream of the Xba I site.
  • 25
    • 0027566636 scopus 로고
    • The TEC1 and STE12 coding sequences were amplified with Pfu polymerase and their 3′ ends were modified to include COOH-terminal FLAG tags. They were then cloned into the Bam HI and Eco RI sites of pMAL-c2 (New England Biolabs), respectively. Expression and purification were performed as described [C. M. Chiang and R. G. Roeder, Pept. Res. 6, 62 (1993)], with minor modifications. A portion of this material was purified further by chromatography on beaded amylose (New England Biolabs).
    • (1993) Pept. Res. , vol.6 , pp. 62
    • Chiang, C.M.1    Roeder, R.G.2
  • 26
    • 1842310119 scopus 로고    scopus 로고
    • note
    • 32P-dCTP and Klenow fragment. The Ty1 competitor DMAs are identical except that the unpaired G residues are not present, and the PRE and TCS mutant competitors contain the appropriate base substitutions. The TEC1 competitor DNAs correspond precisely to the 17-bp TEC1 FRE with 8 bp of its native 5′ and 3′ flanking sequences. Protein-DNA complexes were allowed to form for 90 min at 24°C in binding buffer [20 mM tris-HCl (pH 8.0), 40 mM NaCl, 1 mM dithiothreitol, 5% glycerol, bovine serum albumin (1 mg/ml), and Hae III-digested salmon sperm DNA (100 μm/ml)] in a 20-μl volume. Competitor DNAs were added in a 100-fold molar excess before the addition of proteins. Samples were electrophoresed through a 5% (19:1) acrylamide gel for 3 hours at 13 V/cm, dried, and autoradiographed.
  • 27
    • 1842351387 scopus 로고    scopus 로고
    • note
    • 2, and 1 μl was added to each sample. Reactions were incubated at 24°C for 5 min and were quenched by the addition of an equal volume of stop solution [5 M ammonium acetate, yeast tRNA (300 μg/ml), and 50 mM EDTA].
  • 30
    • 1842387157 scopus 로고    scopus 로고
    • note
    • We thank S. M. Noble and B. M. Cali for critically reading the manuscript and members of the laboratory and fifth floor for helpful discussions. H.D.M is a fellow of the Helen Hay Whitney Foundation. G.R.F. is an American Cancer Society Research Professor of Molecular Genetics.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.