Vascular system defects and impaired cell chemokinesis as a result of Gα13 deficiency

Science

Volumn 275, Issue 5299, 1997, Pages 533-536

  Offermanns, Stefan ^a   Mancino, Valeria ^a   Revel, Jean Paul ^a   Simon, Melvin I ^a  

^a CALIFORNIA INSTITUTE OF TECHNOLOGY   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

GUANINE NUCLEOTIDE BINDING PROTEIN;

ANGIOGENESIS; ARTICLE; CHEMOKINESIS; CONGENITAL BLOOD VESSEL MALFORMATION; EMBRYO; MOUSE; NONHUMAN; PRIORITY JOURNAL; PROTEIN DEFICIENCY; PROTEIN DETERMINATION;

ANIMALS; BLOOD; BRADYKININ; CELL DIFFERENTIATION; CELL MOVEMENT; CELLS, CULTURED; EMBRYO; EMBRYONIC AND FETAL DEVELOPMENT; ENDOTHELIUM, VASCULAR; FEMALE; FIBRONECTINS; GENE EXPRESSION; GENE TARGETING; GTP-BINDING PROTEINS; HETEROZYGOTE; HOMOZYGOTE; LYSOPHOSPHOLIPIDS; MALE; MICE; MICE, INBRED C57BL; NEOVASCULARIZATION, PHYSIOLOGIC; SIGNAL TRANSDUCTION; THROMBIN;

EID: 0031015426     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.275.5299.533     Document Type: Article

References (48)

1. J. R. Hepler and A. G. Gilman, Trends Biochem. Sci. 17, 383 (1992); L. Birnbaumer, Cell 71, 1068 (1992); A. M. Spiegel, A. Shenker, L. S. Weinstein, Endocr. Rev. 13, 536 (1992); E. J. Neer, Cell 80, 249 (1995).
2. J. R. Hepler and A. G. Gilman, Trends Biochem. Sci. 17, 383 (1992); L. Birnbaumer, Cell 71, 1068 (1992); A. M. Spiegel, A. Shenker, L. S. Weinstein, Endocr. Rev. 13, 536 (1992); E. J. Neer, Cell 80, 249 (1995).
3. J. R. Hepler and A. G. Gilman, Trends Biochem. Sci. 17, 383 (1992); L. Birnbaumer, Cell 71, 1068 (1992); A. M. Spiegel, A. Shenker, L. S. Weinstein, Endocr. Rev. 13, 536 (1992); E. J. Neer, Cell 80, 249 (1995).
4. J. R. Hepler and A. G. Gilman, Trends Biochem. Sci. 17, 383 (1992); L. Birnbaumer, Cell 71, 1068 (1992); A. M. Spiegel, A. Shenker, L. S. Weinstein, Endocr. Rev. 13, 536 (1992); E. J. Neer, Cell 80, 249 (1995).
5. M. I. Simon, M. P. Strathmann, N. Gautam, Science 252, 802 (1991).
6. M. P. Strathmann and M. I. Simon, Proc. Natl. Acad. Sci. U.S.A. 88, 5582 (1991).
7. M. V. V. S. Vara Prasad, J. M. Dermott, L. E. Heasley, G. L. Johnson, N. Dhanasekaran, J. Biol. Chem. 270, 18655 (1995).
8. T. Voyno-Yasenetskaya et al., ibid. 269, 4721 (1994); N. Dhanasekaran, M. V. V. S. Vara Prasad, S. J. Wadsworth, J. M. Dermott, G. van Rossum, ibid., p. 11802; R. Hooley, C.-Y. Yu, M. Symons, D. L. Barber, ibid. 271, 6152 (1996).
9. T. Voyno-Yasenetskaya et al., ibid. 269, 4721 (1994); N. Dhanasekaran, M. V. V. S. Vara Prasad, S. J. Wadsworth, J. M. Dermott, G. van Rossum, ibid., p. 11802; R. Hooley, C.-Y. Yu, M. Symons, D. L. Barber, ibid. 271, 6152 (1996).
10. T. Voyno-Yasenetskaya et al., ibid. 269, 4721 (1994); N. Dhanasekaran, M. V. V. S. Vara Prasad, S. J. Wadsworth, J. M. Dermott, G. van Rossum, ibid., p. 11802; R. Hooley, C.-Y. Yu, M. Symons, D. L. Barber, ibid. 271, 6152 (1996).
11. A. M. Buhl, M. L. Johnson, N. Dhanasekaran, G. L. Johnson, ibid. 270, 24631 (1995).
12. S. Offermanns and M. I. Simon, unpublished data.
13. A. Vecchi et al., Eur. J. Cell Biol. 63, 247 (1994); H. S. Baldwin et al., Development 120, 2539 (1994).
14. A. Vecchi et al., Eur. J. Cell Biol. 63, 247 (1994); H. S. Baldwin et al., Development 120, 2539 (1994).
15. W. Risau and I. Flamme, Annu. Rev. Cell Dev. Biol. 11, 73 (1995).
16. D. M. Noden, in The Development of the Vascular System, R. N. Feinberg, G. K. Sherer, R. Auerbach, Eds. (Karger, Basel, 1991), pp. 1-24.
17. F. Shalaby et al., Nature 376, 62 (1995); G.-H. Fong, J. Rossant, M. Gertsenstein, M. L. Breitman, ibid., p. 66; T. N. Sato et al., ibid., p. 70; M. Henkemeyer et al., ibid 377, 695 (1995); P. Carmeliet et al., ibid. 380, 435 (1996); N. Ferrara et al., ibid., p. 439.
18. F. Shalaby et al., Nature 376, 62 (1995); G.-H. Fong, J. Rossant, M. Gertsenstein, M. L. Breitman, ibid., p. 66; T. N. Sato et al., ibid., p. 70; M. Henkemeyer et al., ibid 377, 695 (1995); P. Carmeliet et al., ibid. 380, 435 (1996); N. Ferrara et al., ibid., p. 439.
19. F. Shalaby et al., Nature 376, 62 (1995); G.-H. Fong, J. Rossant, M. Gertsenstein, M. L. Breitman, ibid., p. 66; T. N. Sato et al., ibid., p. 70; M. Henkemeyer et al., ibid 377, 695 (1995); P. Carmeliet et al., ibid. 380, 435 (1996); N. Ferrara et al., ibid., p. 439.
20. F. Shalaby et al., Nature 376, 62 (1995); G.-H. Fong, J. Rossant, M. Gertsenstein, M. L. Breitman, ibid., p. 66; T. N. Sato et al., ibid., p. 70; M. Henkemeyer et al., ibid 377, 695 (1995); P. Carmeliet et al., ibid. 380, 435 (1996); N. Ferrara et al., ibid., p. 439.
21. F. Shalaby et al., Nature 376, 62 (1995); G.-H. Fong, J. Rossant, M. Gertsenstein, M. L. Breitman, ibid., p. 66; T. N. Sato et al., ibid., p. 70; M. Henkemeyer et al., ibid 377, 695 (1995); P. Carmeliet et al., ibid. 380, 435 (1996); N. Ferrara et al., ibid., p. 439.
22. F. Shalaby et al., Nature 376, 62 (1995); G.-H. Fong, J. Rossant, M. Gertsenstein, M. L. Breitman, ibid., p. 66; T. N. Sato et al., ibid., p. 70; M. Henkemeyer et al., ibid 377, 695 (1995); P. Carmeliet et al., ibid. 380, 435 (1996); N. Ferrara et al., ibid., p. 439.
23. E. L. George, E. N. Georges-Labouesse, R. S. Patel-King, H. Rayburn, R. O. Hynes, Development 119, 1079 (1993).
24. J. T. Yang, H. Rayburn, R. O. Hynes. ibid., p. 1093.
25. S. Offermanns, K. L. Laugwitz, K. Spicher, G. Schultz, Proc. Natl. Acad. Sci. U.S.A. 91, 504 (1994).
26. B. M. Gumbiner, Cell 84, 345 (1996); D. A. Lauffenburger and A. F. Horwitz, ibid., p. 359.
27. B. M. Gumbiner, Cell 84, 345 (1996); D. A. Lauffenburger and A. F. Horwitz, ibid., p. 359.
28. C. D. Nobes and A. Hall, ibid. 81, 53 (1995); L. M. Machesky and A. Hall, Trends Cell Biol. 6, 304 (1996); S. H. Zigmond, Curr. Opin. Cell Biol. 8, 66 (1996); S. W. Craig and R. P. Johnson, ibid., p. 74.
29. C. D. Nobes and A. Hall, ibid. 81, 53 (1995); L. M. Machesky and A. Hall, Trends Cell Biol. 6, 304 (1996); S. H. Zigmond, Curr. Opin. Cell Biol. 8, 66 (1996); S. W. Craig and R. P. Johnson, ibid., p. 74.
30. C. D. Nobes and A. Hall, ibid. 81, 53 (1995); L. M. Machesky and A. Hall, Trends Cell Biol. 6, 304 (1996); S. H. Zigmond, Curr. Opin. Cell Biol. 8, 66 (1996); S. W. Craig and R. P. Johnson, ibid., p. 74.
31. C. D. Nobes and A. Hall, ibid. 81, 53 (1995); L. M. Machesky and A. Hall, Trends Cell Biol. 6, 304 (1996); S. H. Zigmond, Curr. Opin. Cell Biol. 8, 66 (1996); S. W. Craig and R. P. Johnson, ibid., p. 74.
32. M. W. Verghese, L. Charles, L. Jakoi, S. B. Dillon, R. Snyderman, J. Immunol. 138, 4374 (1987); S. Sozzani et al., ibid. 147, 2215 (1991); G. Sa and P. L. Fox, J. Biol. Chem 269, 3219 (1994); M. A. del Pozo, P. Sánchez-Mateos, M. Nieto, F. Sánchez-Madrid, J. Cell Biol. 131, 495 (1995).
33. M. W. Verghese, L. Charles, L. Jakoi, S. B. Dillon, R. Snyderman, J. Immunol. 138, 4374 (1987); S. Sozzani et al., ibid. 147, 2215 (1991); G. Sa and P. L. Fox, J. Biol. Chem 269, 3219 (1994); M. A. del Pozo, P. Sánchez-Mateos, M. Nieto, F. Sánchez-Madrid, J. Cell Biol. 131, 495 (1995).
34. M. W. Verghese, L. Charles, L. Jakoi, S. B. Dillon, R. Snyderman, J. Immunol. 138, 4374 (1987); S. Sozzani et al., ibid. 147, 2215 (1991); G. Sa and P. L. Fox, J. Biol. Chem 269, 3219 (1994); M. A. del Pozo, P. Sánchez-Mateos, M. Nieto, F. Sánchez-Madrid, J. Cell Biol. 131, 495 (1995).
35. M. W. Verghese, L. Charles, L. Jakoi, S. B. Dillon, R. Snyderman, J. Immunol. 138, 4374 (1987); S. Sozzani et al., ibid. 147, 2215 (1991); G. Sa and P. L. Fox, J. Biol. Chem 269, 3219 (1994); M. A. del Pozo, P. Sánchez-Mateos, M. Nieto, F. Sánchez-Madrid, J. Cell Biol. 131, 495 (1995).
36. J. Folkman, Nature Med. 1, 27 (1995); D. Hanahan and J. Folkman, Cell 86, 353 (1996).
37. J. Folkman, Nature Med. 1, 27 (1995); D. Hanahan and J. Folkman, Cell 86, 353 (1996).
38. R. Ramírez-Solis, A. N. Davis, A. Bradley, Methods Enzymol. 225, 855 (1993).
39. C. Davis, ibid., p. 502.
40. S. Offermanns and M. I. Simon, J. Biol. Chem 270, 15175 (1995); T. Higgins and E. Rozengurt, in Cell Biology, A Laboratory Handbook, J. E. Celis, Ed. (Academic Press, San Diego, 1994), pp. 294-301.
41. S. Offermanns and M. I. Simon, J. Biol. Chem 270, 15175 (1995); T. Higgins and E. Rozengurt, in Cell Biology, A Laboratory Handbook, J. E. Celis, Ed. (Academic Press, San Diego, 1994), pp. 294-301.
42. 1 were digested with Sma I and hybridized with the diagnostic probe from a 5′ external upstream region, a 0.4-kb Sma I to Eco RI fragment.
43. q (GCCATGATCAGAGCGATGGACACG and CTGGGAAGTAGTCGACTAGGTGGG). Primer sequences were chosen so that primers hybridized to DNA regions encoded by different exons (7) in order to distinguish cDNA-dependent amplification from amplification of genomic DNA.
44. Whole mount immunohistostaining procedure was adapted from (20). Detergent was omitted from every step, and the entire procedure was performed at room temperature. Dissected yolk sacs were fixed in 4% paraformaldehyde, stored in methanol, and rehydrated before immunostaining. After incubation for 1 hour with dry milk (3% w/v), yolk sacs were incubated for another hour with anti-PECAM-1 (rat monoclonal antibody MEC 13.3, Pharmingen; 20 μg/ml), washed, and incubated for about 40 min with alkaline phosphatase-conjugated goat anti-rat immunoglobulin G (Sigma). Yolk sacs were washed extensively, and color reaction was started by addition of 5-bromo-4-chloro-3-indoyl phosphate (BCIP) and nitro blue tetrazolium (NBT). The reaction was stopped after about 30 min.
45. 4, embedded in Epon, sectioned at 0.5 μm, and stained with toluidin blue.
46. 3H]thymidine incorporation of serum-starved cells were determined as described (21).
47. 6 cells/ml) and stimuli were prepared in serum-free Dulbecco's minimum essential medium. Stimuli or control solutions (30 μl) were placed in the lower compartment of a 48-well migration chamber (NeuroProbe). Wells were overlaid with a polycarbonate membrane (pore size, 8 μm; NeuroProbe), and 50 μl of cell suspension was added to the top well. Chambers were incubated for 16 hours at 37°C, then membranes were removed, fixed in methanol, and stained with hematoxylin. We quantified cells that had migrated through the filter by counting six nonoverlaping fields at 200x magnification. To determine whether the migration of cells in response to thrombin was chemotactic or chemokinetic, we performed checkerboard experiments (7). In the presence of a negative ligand gradient (higher concentration on the cellular site), there was still migration of cells on the upper site of the filter (about 60 to 70% compared to positive gradient conditions). Equal concentrations of thrombin on both sites resulted in cell migration comparable to that under a positive gradient, indicating that the observed migration was predominantly chemokinetic.
48. We thank J. Edens, Y.-H. Hu, and the La Jolla Cancer Research Foundation for technical assistance; T. Gridley for ES cell line CJ7; and A. Aragay, S. Pease, H. Wang, T. Wieland, and J. T. Yang for helpful suggestions. Supported by NIH grants GM 34236 and AG 12288 (M.I.S.). S.O. was a recipient of a fellowship from the Deutsche Forschungsgemeinschaft and the Guenther Foundation.