메뉴 건너뛰기




Volumn 271, Issue 5247, 1996, Pages 350-353

DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1

Author keywords

[No Author keywords available]

Indexed keywords

DNA BINDING PROTEIN; PROTEIN; SMAD4 PROTEIN; SMAD4 PROTEIN, HUMAN; SMAD4 PROTEIN, MOUSE; TRANSACTIVATOR PROTEIN; TRANSFORMING GROWTH FACTOR BETA;

EID: 0030593038     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.271.5247.350     Document Type: Article
Times cited : (2208)

References (36)
  • 1
    • 0026337295 scopus 로고
    • R. A Weinberg, Science 254, 1138 (1991); J. M Bishop, ibid. 235, 305 (1987).
    • (1991) Science , vol.254 , pp. 1138
    • Weinberg, R.A.1
  • 2
    • 0023145547 scopus 로고
    • R. A Weinberg, Science 254, 1138 (1991); J. M Bishop, ibid. 235, 305 (1987).
    • (1987) Science , vol.235 , pp. 305
    • Bishop, J.M.1
  • 5
    • 0025056930 scopus 로고
    • T. P. Dryja, J. M Rapaport, J. M. Joyce, R. A Petersen, Proc. Natl. Acad. Sci. U.S A 83, 7391 (1986); E. R. Fearon et al., Science 247, 49 (1990); A. Kamb et al., ibid. 264, 436 (1994).
    • (1990) Science , vol.247 , pp. 49
    • Fearon, E.R.1
  • 6
    • 0028121279 scopus 로고
    • T. P. Dryja, J. M Rapaport, J. M. Joyce, R. A Petersen, Proc. Natl. Acad. Sci. U.S A 83, 7391 (1986); E. R. Fearon et al., Science 247, 49 (1990); A. Kamb et al., ibid. 264, 436 (1994).
    • (1994) Science , vol.264 , pp. 436
    • Kamb, A.1
  • 7
    • 0024292722 scopus 로고
    • C. Almoguerra et al., Cell 53, 549 (1988); R. H Hruban et al , Am. J. Pathol. 143, 545 (1993).
    • (1988) Cell , vol.53 , pp. 549
    • Almoguerra, C.1
  • 8
    • 0027733796 scopus 로고
    • C. Almoguerra et al., Cell 53, 549 (1988); R. H Hruban et al , Am. J. Pathol. 143, 545 (1993).
    • (1993) Am. J. Pathol. , vol.143 , pp. 545
    • Hruban, R.H.1
  • 12
    • 0028314271 scopus 로고
    • K. R. Cho et al., Genomics 19, 525 (1994).
    • (1994) Genomics , vol.19 , pp. 525
    • Cho, K.R.1
  • 14
    • 4243054605 scopus 로고    scopus 로고
    • or from the Human Genome Database (http://gdbwww.gdb.org/)
    • Data on microsatellite markers, and the corresponding primer sequences, were accessed through the Cooperative Human Linkage Center (http://www. chlc.org/HomePage.html) or from the Human Genome Database (http://gdbwww.gdb.org/).
  • 15
    • 4243065925 scopus 로고    scopus 로고
    • note
    • The methods for establishing xenografts and for PCR and multiplex PCR assays were as in (7), and for Southern blots as in (6). STS markers used to exclude the involvement of DCC were SSAV, D18S523, D18S526, D18S101, and the microsatellite marker DCC (15). All PCR reactions were repeated at least three times and confirmed by a second primer pair designed on nearby sequences to exclude the possibility of a primer site polymorphism. The quality of the DNA was further ensured by the successful amplification of a 1.8-kb fragment (exons 5 to 9 of p53) and of numerous primer sets for microsatellite markers.
  • 17
    • 84901957018 scopus 로고    scopus 로고
    • in press
    • YAC ends were isolated by the inverse PCR technique (28). The amplified ligation fragments were sequenced by cycle sequencing (SequiTerm, Epicentre Technologies, Madison), and 20-mer oligonucleotide pairs for STS markers were designed PCR analysis of monochromosomal somatic ceil hybrid DNA (NIGMS mapping panel 2, Conell Cell Repositories) confirmed STS localization to chromosome 18. The full genomic map is published [S. A. Hahn et al , Cancer Res., in press]
    • Cancer Res.
    • Hahn, S.A.1
  • 20
    • 4243111442 scopus 로고    scopus 로고
    • note
    • A PCR-based P1 screening was performed by Genome Systems, St. Louis, with STS markers flanking the consensus deletion. Positive P1 clones from the DuPont Merck Pharmaceutical Company Human Foreskin Fibroblast Library 1 (DMPC-HFF#1) were: 1210-C10, 0960-F5, and 0630-H5. We performed a second screen with human PAC library (purchased from Genome Systems) by hybridizing a random primer-labeled PCR product to gridded PAC library filters
  • 21
    • 0028949381 scopus 로고    scopus 로고
    • Partial Nde II-digested YAC DNA was subcloned into the SuperCos-1 vector (Stratagene). Cosmids were screened and identified by PCR with STS markers derived from the region of interest and were sequenced using primers specific for vector sequences. P1-PAC end sequences were generated by direct sequencing or by a PCR-based amplification technique [Y.-G. Liu, R. F. Whittier, Genomics 25, 674 (1995) and L. T da Costa, unpublished data]
    • (1995) Genomics , vol.25 , pp. 674
    • Liu, Y.-G.1    Whittier, R.F.2
  • 22
    • 0028949381 scopus 로고    scopus 로고
    • unpublished data
    • Partial Nde II-digested YAC DNA was subcloned into the SuperCos-1 vector (Stratagene). Cosmids were screened and identified by PCR with STS markers derived from the region of interest and were sequenced using primers specific for vector sequences. P1-PAC end sequences were generated by direct sequencing or by a PCR-based amplification technique [Y.-G. Liu, R. F. Whittier, Genomics 25, 674 (1995) and L. T da Costa, unpublished data]
    • Da Costa, L.T.1
  • 23
    • 4243102524 scopus 로고    scopus 로고
    • note
    • For exon amplification, DNA from cosmid C917-46 was digested with Bam HI and Bgl II and ligated into the pSPL3 exon-trapping vector (Gibco/BRL). Exontrapped sequences were analyzed by BLAST homology searches The location of the exon-trapped sequences to the region was confirmed by Southern blot analysis of Eco RI-digested DNA of cosmid C917-46. 5′-RACE was performed according to the manufacturer's instructions (Clontech, Palo Alto). cDNA library screening was performed with exontrapped sequences or Eco RI restriction fragments from c917-46 as probes. The cDNA libraries were derived from HeLa cells, human placenta, and human fetal brain (Stratagene), and the human cotorectal cancer cell line SW480 (Clontech).
  • 24
    • 4243116038 scopus 로고    scopus 로고
    • note
    • These 61 xenografts included 28 from the initial panel and 33 new ones.
  • 25
    • 0027763498 scopus 로고
    • The protein assay was performed with the TNT kit (Promega). Primer sequences (5′ to 3′) were: DPC4S, GGATCCTAATACGACTCACTATAGGGC-CGCCACCATGGCCTGTCTGAGCATTGTGCATAG; and DPC4AS, CAGTTTCTGTCTGCTAGGAG [M W Powell et al., N. Engl. J. Med. 329, 1982 (1993)].
    • (1993) N. Engl. J. Med. , vol.329 , pp. 1982
    • Powell, M.W.1
  • 26
    • 4243152592 scopus 로고    scopus 로고
    • note
    • PCR amplification of the exons was performed as in (29) Mutations were confirmed in a second PCR reaction. The PCR primer sequences are available upon request, Intronic primers were generally used to amplify exons from the xenografts grown in mice, because exonic primers generated PCR products from mouse DNA that were identical in size to the human PCR products.
  • 27
    • 4243148109 scopus 로고    scopus 로고
    • note
    • Direct sequencing of microdissected tumor cells was achieved in two of the six tumors with DPC4 mutations. Contamination of normal cells in primary pancreatic carcinomas usually precludes direct genetic study (7).
  • 30
  • 31
    • 0028168242 scopus 로고
    • M. G Alexandrow and H. Moses, Cancer Res. 55, 1452 (1995); G. J Hannon and D Beach, Nature 371, 257 (1994).
    • (1994) Nature , vol.371 , pp. 257
    • Hannon, G.J.1    Beach, D.2
  • 32
    • 0029066689 scopus 로고
    • S. Markowitz et al., Science 268, 1336 (1995).
    • (1995) Science , vol.268 , pp. 1336
    • Markowitz, S.1
  • 36
    • 4243072632 scopus 로고    scopus 로고
    • note
    • We thank K. W. Kinzter and B. Vogelstein for cDNA library clones. Supported by the SPORE in Gastrointestinal Cancer, NIH grant CA62924, Deutsche Krebshilfe (S A H.), and Junta Nacional de Investigaçäo Científica e Technológica Scholarship BD1508/ 91 (L T C ) S.K is a McDonnell Foundation Scholar.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.