Immunologic NO synthase: Elevation in severe AIDS dementia and induction by HIV-1 gp41

Science

Volumn 274, Issue 5294, 1996, Pages 1917-1921

  Adamson, D Cory ^a   Wildemann, Brigitte ^a,c   Sasaki, Masayuki ^a   Glass, Jonathan D ^a,d   McArthur, Justin C ^a,b   Christov, Vesselin I ^a   Dawson, Ted M ^a   Dawson, Valina L ^a  

^a JOHNS HOPKINS UNIVERSITY SCHOOL OF MEDICINE   (United States)

^b JOHNS HOPKINS BLOOMBERG SCHOOL OF PUBLIC HEALTH   (United States)

^c UNIVERSITY OF HEIDELBERG   (Germany)

^d EMORY UNIVERSITY SCHOOL OF MEDICINE   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

ANTIGEN P24; BETA TUBULIN; GLYCOPROTEIN GP 120; GLYCOPROTEIN GP 41; NITRIC OXIDE SYNTHASE;

ACQUIRED IMMUNE DEFICIENCY SYNDROME; ANIMAL CELL; ARTICLE; BRAIN TISSUE; CONTROLLED STUDY; ENZYME INDUCTION; GLIA CELL; HUMAN; HUMAN IMMUNODEFICIENCY VIRUS INFECTION; HUMAN TISSUE; NERVE CELL NECROSIS; NONHUMAN; PRIORITY JOURNAL; RAT;

AIDS DEMENTIA COMPLEX; ANIMALS; BRAIN; CELL DEATH; CELLS, CULTURED; CEREBRAL CORTEX; ENZYME INDUCTION; HIV ENVELOPE PROTEIN GP120; HIV ENVELOPE PROTEIN GP41; HIV-1; HUMANS; NEUROGLIA; NEURONS; NITRIC OXIDE; NITRIC OXIDE SYNTHASE; POLYMERASE CHAIN REACTION; RATS;

ANIMALIA; HUMAN IMMUNODEFICIENCY VIRUS; HUMAN IMMUNODEFICIENCY VIRUS 1;

EID: 0030451407     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.274.5294.1917     Document Type: Article

References (76)

1. B. Navia, B. Jordan, R. Price, Ann. Neurol. 19, 517 (1986); R. Price et al., Science 239, 586 (1988); M. J. G. Harrison and J. C, McArthur, in AIDS in Neurology (Churchil-Livingston, New York, 1995), pp. 32-36.
2. B. Navia, B. Jordan, R. Price, Ann. Neurol. 19, 517 (1986); R. Price et al., Science 239, 586 (1988); M. J. G. Harrison and J. C, McArthur, in AIDS in Neurology (Churchil-Livingston, New York, 1995), pp. 32-36.
3. B. Navia, B. Jordan, R. Price, Ann. Neurol. 19, 517 (1986); R. Price et al., Science 239, 586 (1988); M. J. G. Harrison and J. C, McArthur, in AIDS in Neurology (Churchil-Livingston, New York, 1995), pp. 32-36.
4. J. D. Glass, H. Fedor, S. L, Wesselingh, J. C. McArthur, Ann. Neurol. 38, 755 (1995).
5. S. Koenig et al., Science 233, 1089 (1986); D. W. Dickson and S. C. Lee, J. Neuro-AIDS 1, 57 (1996); K. Takahashi et al., Ann. Neurol. 39 705 (1996).
6. S. Koenig et al., Science 233, 1089 (1986); D. W. Dickson and S. C. Lee, J. Neuro-AIDS 1, 57 (1996); K. Takahashi et al., Ann. Neurol. 39 705 (1996).
7. S. Koenig et al., Science 233, 1089 (1986); D. W. Dickson and S. C. Lee, J. Neuro-AIDS 1, 57 (1996); K. Takahashi et al., Ann. Neurol. 39 705 (1996).
8. T. Saito et al., Neurology 44, 474 (1994); C. Tornatore, R. Chandra, J. R. Berger, E. O. Major, ibid., p. 481.
9. T. Saito et al., Neurology 44, 474 (1994); C. Tornatore, R. Chandra, J. R. Berger, E. O. Major, ibid., p. 481.
10. I. P. Everall, P. J. Luthert, P. L. Lantos, Lancet 337, 1119 (1991); C. A. Wiley et al., Ann. Neurol. 29, 651 (1991); E. Masliah et al., Lab. Invest. 66, 285 (1992).
11. I. P. Everall, P. J. Luthert, P. L. Lantos, Lancet 337, 1119 (1991); C. A. Wiley et al., Ann. Neurol. 29, 651 (1991); E. Masliah et al., Lab. Invest. 66, 285 (1992).
12. I. P. Everall, P. J. Luthert, P. L. Lantos, Lancet 337, 1119 (1991); C. A. Wiley et al., Ann. Neurol. 29, 651 (1991); E. Masliah et al., Lab. Invest. 66, 285 (1992).
13. B. A. Navia, E. Cho, R. W. Price, Ann. Neurol. 19, 525 (1986); C. K. Petito and K. S. Cash, ibid. 32, 658 (1992); C. Power et al., ibid. 34, 339 (1993).
14. B. A. Navia, E. Cho, R. W. Price, Ann. Neurol. 19, 525 (1986); C. K. Petito and K. S. Cash, ibid. 32, 658 (1992); C. Power et al., ibid. 34, 339 (1993).
15. B. A. Navia, E. Cho, R. W. Price, Ann. Neurol. 19, 525 (1986); C. K. Petito and K. S. Cash, ibid. 32, 658 (1992); C. Power et al., ibid. 34, 339 (1993).
16. J. D. Glass, S. L. Wesselingh, O. A. Seines, J. C. McArthur, Neurology 43, 2230 (1993).
17. R. Vazeux et al., Am. J. Pathol. 140, 137 (1992).
18. L. G. Epstein and H. E. Gendelman, Ann. Neurol. 33, 429 (1993); S. A. Lipton and H. E. Gendelman, N. Engl. J. Med. 332, 934 (1995).
19. L. G. Epstein and H. E. Gendelman, Ann. Neurol. 33, 429 (1993); S. A. Lipton and H. E. Gendelman, N. Engl. J. Med. 332, 934 (1995).
20. C. A. Wiley and C. L. Achim, Ann. Neurol. 36, 673 (1994); B. J, Brew, M. Rosenblum, K. Cronin, R. W. Price, ibid. 38, 563 (1995); S. Pang et al., Nature 343, 85 (1990). Some studies suggest a correlation between the HIV-1 antigens in the brain and the presence of dementia, whereas other investigators do not find such a clear relatbn. Furthermore, HIV-1 antigen burden may not indicate viral burden [R. T. Johnson, J. D. Glass, J. C. McArthur, B. W. Chesebro, Ann. Neurol. 39, 392 (1996)].
21. C. A. Wiley and C. L. Achim, Ann. Neurol. 36, 673 (1994); B. J, Brew, M. Rosenblum, K. Cronin, R. W. Price, ibid. 38, 563 (1995); S. Pang et al., Nature 343, 85 (1990). Some studies suggest a correlation between the HIV-1 antigens in the brain and the presence of dementia, whereas other investigators do not find such a clear relatbn. Furthermore, HIV-1 antigen burden may not indicate viral burden [R. T. Johnson, J. D. Glass, J. C. McArthur, B. W. Chesebro, Ann. Neurol. 39, 392 (1996)].
22. C. A. Wiley and C. L. Achim, Ann. Neurol. 36, 673 (1994); B. J, Brew, M. Rosenblum, K. Cronin, R. W. Price, ibid. 38, 563 (1995); S. Pang et al., Nature 343, 85 (1990). Some studies suggest a correlation between the HIV-1 antigens in the brain and the presence of dementia, whereas other investigators do not find such a clear relatbn. Furthermore, HIV-1 antigen burden may not indicate viral burden [R. T. Johnson, J. D. Glass, J. C. McArthur, B. W. Chesebro, Ann. Neurol. 39, 392 (1996)].
23. C. A. Wiley and C. L. Achim, Ann. Neurol. 36, 673 (1994); B. J, Brew, M. Rosenblum, K. Cronin, R. W. Price, ibid. 38, 563 (1995); S. Pang et al., Nature 343, 85 (1990). Some studies suggest a correlation between the HIV-1 antigens in the brain and the presence of dementia, whereas other investigators do not find such a clear relatbn. Furthermore, HIV-1 antigen burden may not indicate viral burden [R. T. Johnson, J. D. Glass, J. C. McArthur, B. W. Chesebro, Ann. Neurol. 39, 392 (1996)].
24. D.E. Brenneman et al., Nature 335, 639 (1988); S.A. Lipton, N. J. Sucher, E. B. Dreyer, Neuron 7, 111 (1991); S. A. Lipton, Trends Neurosci. 15, 75 (1992); T. Savio and G. Levi, J. Neurosci. Res. 34, 265 (1993); E. B. Dreyer, P. K. Kaiser, J. T. Offermann, S. A. Lipton, Science 248, 364 (1990).
25. D.E. Brenneman et al., Nature 335, 639 (1988); S.A. Lipton, N. J. Sucher, E. B. Dreyer, Neuron 7, 111 (1991); S. A. Lipton, Trends Neurosci. 15, 75 (1992); T. Savio and G. Levi, J. Neurosci. Res. 34, 265 (1993); E. B. Dreyer, P. K. Kaiser, J. T. Offermann, S. A. Lipton, Science 248, 364 (1990).
26. D.E. Brenneman et al., Nature 335, 639 (1988); S.A. Lipton, N. J. Sucher, E. B. Dreyer, Neuron 7, 111 (1991); S. A. Lipton, Trends Neurosci. 15, 75 (1992); T. Savio and G. Levi, J. Neurosci. Res. 34, 265 (1993); E. B. Dreyer, P. K. Kaiser, J. T. Offermann, S. A. Lipton, Science 248, 364 (1990).
27. D.E. Brenneman et al., Nature 335, 639 (1988); S.A. Lipton, N. J. Sucher, E. B. Dreyer, Neuron 7, 111 (1991); S. A. Lipton, Trends Neurosci. 15, 75 (1992); T. Savio and G. Levi, J. Neurosci. Res. 34, 265 (1993); E. B. Dreyer, P. K. Kaiser, J. T. Offermann, S. A. Lipton, Science 248, 364 (1990).
28. D.E. Brenneman et al., Nature 335, 639 (1988); S.A. Lipton, N. J. Sucher, E. B. Dreyer, Neuron 7, 111 (1991); S. A. Lipton, Trends Neurosci. 15, 75 (1992); T. Savio and G. Levi, J. Neurosci. Res. 34, 265 (1993); E. B. Dreyer, P. K. Kaiser, J. T. Offermann, S. A. Lipton, Science 248, 364 (1990).
29. V. L Dawson, T. M. Dawson, G. R. Uhl, S. H. Snyder, Proc. Natl. Acad. Sci. U.S.A. 90, 3256 (1993).
30. E. Bonofoco et al., ibid. 92, 7162 (1995).
31. D. C. Adamson, T. M. Dawson, M. C Zink, J. E. Clements, V. L. Dawson, Mol. Med. 2, 417 (1996).
32. C. K. Petito and B. Roberts, Am. J. Pathol. 146, 1121 (1995); H. Adlebiassette et al, Neuropath. Appl. Neurobiol. 21, 218 (1995); H. A. Gelbard et al., ibid., p. 208.
33. C. K. Petito and B. Roberts, Am. J. Pathol. 146, 1121 (1995); H. Adlebiassette et al, Neuropath. Appl. Neurobiol. 21, 218 (1995); H. A. Gelbard et al., ibid., p. 208.
34. C. K. Petito and B. Roberts, Am. J. Pathol. 146, 1121 (1995); H. Adlebiassette et al, Neuropath. Appl. Neurobiol. 21, 218 (1995); H. A. Gelbard et al., ibid., p. 208.
35. L. Wahl et al., Proc. Natl. Acad. Sci. U.S.A. 86, 621 (1989); H. A. Gelbard et al., J. Virol. 68, 4628 (1994); D. Giulian, K. Vaca, C. A. Noonan, Science 250, 1593 (1990).
36. L. Wahl et al., Proc. Natl. Acad. Sci. U.S.A. 86, 621 (1989); H. A. Gelbard et al., J. Virol. 68, 4628 (1994); D. Giulian, K. Vaca, C. A. Noonan, Science 250, 1593 (1990).
37. L. Wahl et al., Proc. Natl. Acad. Sci. U.S.A. 86, 621 (1989); H. A. Gelbard et al., J. Virol. 68, 4628 (1994); D. Giulian, K. Vaca, C. A. Noonan, Science 250, 1593 (1990).
38. J. E. Merrill et al., J. Virol. 66, 2217 (1992); P Koka et al., J. Exp. Med. 182, 941 (1995).
39. J. E. Merrill et al., J. Virol. 66, 2217 (1992); P Koka et al., J. Exp. Med. 182, 941 (1995).
40. P. Genis et al., J. Exp. Med. 176, 1703 (1992); M. I. Bukrinsky et al., ibid. 181, 735 (1995); D. Pietraforte, E. Tritarelli, U. Testa, M. Minetti, J. Leukocyte Biol. 55, 175 (1994); V. Mollace et al., Biophys. Biochem. Res. Commun. 134, 439 (1993).
41. P. Genis et al., J. Exp. Med. 176, 1703 (1992); M. I. Bukrinsky et al., ibid. 181, 735 (1995); D. Pietraforte, E. Tritarelli, U. Testa, M. Minetti, J. Leukocyte Biol. 55, 175 (1994); V. Mollace et al., Biophys. Biochem. Res. Commun. 134, 439 (1993).
42. P. Genis et al., J. Exp. Med. 176, 1703 (1992); M. I. Bukrinsky et al., ibid. 181, 735 (1995); D. Pietraforte, E. Tritarelli, U. Testa, M. Minetti, J. Leukocyte Biol. 55, 175 (1994); V. Mollace et al., Biophys. Biochem. Res. Commun. 134, 439 (1993).
43. P. Genis et al., J. Exp. Med. 176, 1703 (1992); M. I. Bukrinsky et al., ibid. 181, 735 (1995); D. Pietraforte, E. Tritarelli, U. Testa, M. Minetti, J. Leukocyte Biol. 55, 175 (1994); V. Mollace et al., Biophys. Biochem. Res. Commun. 134, 439 (1993).
44. C.C. Chao,S. Hu,T. W. Molitor,E.G.Shaskar,P. K. Peterson, J. Immunol. 149, 2736 (1992); K. M. Boje and P. K. Arora, Brain Res. 587, 250 (1992); V. L. Dawson, K.P., Brahmbhatt, J. A. Mong, T. M. Dawson. Neuropharmacology 33, 1425 (1994); S. J. Hewett, C. A. Csemasnsky, D. W. Choi. Neuron 13, 487 (1994).
45. C.C. Chao,S. Hu,T. W. Molitor,E.G.Shaskar,P. K. Peterson, J. Immunol. 149, 2736 (1992); K. M. Boje and P. K. Arora, Brain Res. 587, 250 (1992); V. L. Dawson, K.P., Brahmbhatt, J. A. Mong, T. M. Dawson. Neuropharmacology 33, 1425 (1994); S. J. Hewett, C. A. Csemasnsky, D. W. Choi. Neuron 13, 487 (1994).
46. C.C. Chao,S. Hu,T. W. Molitor,E.G.Shaskar,P. K. Peterson, J. Immunol. 149, 2736 (1992); K. M. Boje and P. K. Arora, Brain Res. 587, 250 (1992); V. L. Dawson, K.P., Brahmbhatt, J. A. Mong, T. M. Dawson. Neuropharmacology 33, 1425 (1994); S. J. Hewett, C. A. Csemasnsky, D. W. Choi. Neuron 13, 487 (1994).
47. C.C. Chao,S. Hu,T. W. Molitor,E.G.Shaskar,P. K. Peterson, J. Immunol. 149, 2736 (1992); K. M. Boje and P. K. Arora, Brain Res. 587, 250 (1992); V. L. Dawson, K.P., Brahmbhatt, J. A. Mong, T. M. Dawson. Neuropharmacology 33, 1425 (1994); S. J. Hewett, C. A. Csemasnsky, D. W. Choi. Neuron 13, 487 (1994).
48. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
49. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
50. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
51. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
52. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
53. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
54. J. E. Merrill, L J. Ignarro, M. P. Sherman, J. Melinek, T. Lane, J. Immunol. 151, 2132 (1993); B. Mitrovic, L. J Ignarro, S. Montestruque, A. Smoll, J. E. Merrill, Neuroscience 61, 575 (1994); A. J. Mackenzie-Graham, B. Mitrovic, A. Smoll, J. E. Merrill, Dev. Neurosci. 16, 162 (1994); S. L. Wesselingh et al., Ann. Neurol. 33, 576 (1993); W. R. Tyor et al., ibid. 31, 349 (1992); W. R. Tyor et al., Neurology 43, 1002 (1993); D. E. Griffin, S. L. Wesselingh, J. C. McArthur et al., Ann. Neurol. 35, 592 (1994).
55. Tissue was collected at autopsy from a prospectively characterized population of AIDS patients, rapidly frozen in isopentane, and stored at -70°C. In 28 cases, cortical specimens were obtained from the frontal lobe. In one seronegative control patient, cortical tissue was derived from the cingulate gyrus. In three HIV-1-infected individuals, tissue samples from both frontal and parietal cortical regions were simultaneously assessed. One of these patients was nondemented, and two patients had mild and severe dementia, respectively. In all patients, the presence of CNS opportunistic infections or lymphoma was excluded by computed tomography or magnetic resonance imaging and cerebrospinal fluid analysis, as well as by postmortem histopathologic evaluation of brain tissue sections. HIV-1-seronegative control specimens were obtained from patients without CNS lesions. The causes of death in control patients included myocardial infarction, trauma, cirrhosis of the liver, atherosclerosis, and widespread cytomegalovirus infection. The mean ages and postmortem delays were similar for all patient groups, and CD4 counts did not differ between AIDS patients without dementia and those with mild or severe dementia. Postmortem delays in tissue collection were as follows: seronegative control, 15.0 ± 3.0 hours; HIV-1 positive (AIDS) with no dementia, 13.7 ± 1.8 hours; HIV-1 positive with mild dementia, 17.9 ± 3.3 hours; and HIV-1 positive with severe dementia 14.9 ± 3.1 hours. A mean CD4 count (number of cells per cubic millimeter) was not done for the seronegative control. It was 51.4 ± 29.1 for HIV-1 - positive patients with no dementia; 38.6 ± 15.3 for HIV-1-positive patients with mild dementia; and 39.0 ± 24.0 for HIV-1-positive patients with severe dementia. 22. R. W. Price and B. J. Brew, J. Infect. Dis. 158, 1079 (1988); R. S. Janssen et al., Neurology 41, 778 (1991). The patients were grouped according to MSK criteria for HIV-associated dementia as nondemented (MSK 0), mildly demented (MSK 1 or 2), or severely demented (MSK 3 or 4).
56. Tissue was collected at autopsy from a prospectively characterized population of AIDS patients, rapidly frozen in isopentane, and stored at -70°C. In 28 cases, cortical specimens were obtained from the frontal lobe. In one seronegative control patient, cortical tissue was derived from the cingulate gyrus. In three HIV-1-infected individuals, tissue samples from both frontal and parietal cortical regions were simultaneously assessed. One of these patients was nondemented, and two patients had mild and severe dementia, respectively. In all patients, the presence of CNS opportunistic infections or lymphoma was excluded by computed tomography or magnetic resonance imaging and cerebrospinal fluid analysis, as well as by postmortem histopathologic evaluation of brain tissue sections. HIV-1-seronegative control specimens were obtained from patients without CNS lesions. The causes of death in control patients included myocardial infarction, trauma, cirrhosis of the liver, atherosclerosis, and widespread cytomegalovirus infection. The mean ages and postmortem delays were similar for all patient groups, and CD4 counts did not differ between AIDS patients without dementia and those with mild or severe dementia. Postmortem delays in tissue collection were as follows: seronegative control, 15.0 ± 3.0 hours; HIV-1 positive (AIDS) with no dementia, 13.7 ± 1.8 hours; HIV-1 positive with mild dementia, 17.9 ± 3.3 hours; and HIV-1 positive with severe dementia 14.9 ± 3.1 hours. A mean CD4 count (number of cells per cubic millimeter) was not done for the seronegative control. It was 51.4 ± 29.1 for HIV-1 - positive patients with no dementia; 38.6 ± 15.3 for HIV-1-positive patients with mild dementia; and 39.0 ± 24.0 for HIV-1-positive patients with severe dementia. 22. R. W. Price and B. J. Brew, J. Infect. Dis. 158, 1079 (1988); R. S. Janssen et al., Neurology 41, 778 (1991). The patients were grouped according to MSK criteria for HIV-associated dementia as nondemented (MSK 0), mildly demented (MSK 1 or 2), or severely demented (MSK 3 or 4).
57. 32P]dATP (6000 Ci/mmol) by terminal transferase with the use of the DNA 3′ end-labeling kit (Boehringer Mannheim]. The nucleotide sequences of the internal oligonucleotides were AGTTTCTGGCAGCAACGGCTCCATGACTCCCAGCACAG (40-nucleotide oligomer, sense strand) for iNOS and TGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAG (40-nucleotide oligomer, sense strand) for β-actin. Filters were prehybridized and hybridized in Church and Gilbert hybridization solution [G. M. Church and W. Gilbert, Proc. Nail. Acad. Sci. U.S.A. 81. 1991 (1984)]. Hybridization was performed at 60°C for 12 to 14 hours. The membranes were washed twice in 2x saline sodium citrate (SSC) and 0.1% SDS at room temperature for 10 min. This was followed by high-stringency washes in 0.2x SSC and 0.1% SDS at 60°C for 15 min. The filters were exposed to phosphor screens for 2 to 10 hours. The counts per band were measured by phosphorimaging (Molecular Dynamics) and used to determine the relative ratios of the intensity of the iNOS band to that of the β-actin band.
58. 32P]dATP (6000 Ci/mmol) by terminal transferase with the use of the DNA 3′ end-labeling kit (Boehringer Mannheim]. The nucleotide sequences of the internal oligonucleotides were AGTTTCTGGCAGCAACGGCTCCATGACTCCCAGCACAG (40-nucleotide oligomer, sense strand) for iNOS and TGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAG (40-nucleotide oligomer, sense strand) for β-actin. Filters were prehybridized and hybridized in Church and Gilbert hybridization solution [G. M. Church and W. Gilbert, Proc. Nail. Acad. Sci. U.S.A. 81. 1991 (1984)]. Hybridization was performed at 60°C for 12 to 14 hours. The membranes were washed twice in 2x saline sodium citrate (SSC) and 0.1% SDS at room temperature for 10 min. This was followed by high-stringency washes in 0.2x SSC and 0.1% SDS at 60°C for 15 min. The filters were exposed to phosphor screens for 2 to 10 hours. The counts per band were measured by phosphorimaging (Molecular Dynamics) and used to determine the relative ratios of the intensity of the iNOS band to that of the β-actin band.
59. 32P]dATP (6000 Ci/mmol) by terminal transferase with the use of the DNA 3′ end-labeling kit (Boehringer Mannheim]. The nucleotide sequences of the internal oligonucleotides were AGTTTCTGGCAGCAACGGCTCCATGACTCCCAGCACAG (40-nucleotide oligomer, sense strand) for iNOS and TGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAG (40-nucleotide oligomer, sense strand) for β-actin. Filters were prehybridized and hybridized in Church and Gilbert hybridization solution [G. M. Church and W. Gilbert, Proc. Nail. Acad. Sci. U.S.A. 81. 1991 (1984)]. Hybridization was performed at 60°C for 12 to 14 hours. The membranes were washed twice in 2x saline sodium citrate (SSC) and 0.1% SDS at room temperature for 10 min. This was followed by high-stringency washes in 0.2x SSC and 0.1% SDS at 60°C for 15 min. The filters were exposed to phosphor screens for 2 to 10 hours. The counts per band were measured by phosphorimaging (Molecular Dynamics) and used to determine the relative ratios of the intensity of the iNOS band to that of the β-actin band.
60. B. Wildemann, M. Sasaki, V. I. Christov, T. M. Dawson, V. L. Dawson, unpublished observations.
61. The iNOS PCR products obtained by several reactions were assessed by nucleotide sequence analysis Sequencing was performed by the Genetics Resources CORE Facility of the Johns Hopkins University School of Medicine, with the use of the fluores-cent dideoxy chain termination method using an automated DNA sequencer (model 373A, Applied Biosystems, Foster City, CA).
62. D. A. Geller et al., Proc. Natl. Acad. Sci. U.S.A. 90, 3491 (1993).
63. Immunoblot analysis of iNOS, p24, gp41, gp120, and β-tubulin was perfomed as described [A. H. Sharp et al., Neuron 14, 1065 (1995)]. Briefly, tissues were homogenized in ice-cold 50 mM Hepes (pH 7.4) with 1 mM β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamide, leupeptin (10 mg/ml), pepstatin A(10mg/ml), aprotinin(1 mg/ml),and 1 mM EDTA,and centnfuged at 100,000g for 60 min. Polyacrylamide gel electrophoresis (PAGE) on a 5 to 16% gradient was used to separate proteins. After electrophoresis, proteins were electroblotted onto nitrocellulose and incubated with antibody to macNOS (1:500; Transduction Laboratories, Lexington. KY); antibody to p24 (HIV-1) (1:1000; Intracel, Cambridge, MA); antibody to gp41 (1:250; Intracel); antibody to gp120 (HIV-1), which recognizes recombinant gp120 and native gp120 from extracts of HIV-1-infected cells in protein immunoblots (1:250, Intracel); and antibody to ß-tubulin (1:10000; Sigma), respectively. For gp41 protein analysis, equivalent amounts of protein lysate prepared from each of the pellet fractions after a 60-min 100,000g spin were resolved with PAGE on a 4 to 20% gradient. SDS (0.1%) was added to the tris-glycine buffer and Tween 20 (0.1%) was added to the phosphate-buffered saline for rinsing steps. Immunoblots were developed by enhanced chemoluminescence (Kirkegaard 8 Perry, Gaithersburg, MD). The specificity of the antibody to gp41 was demonstrated by immunoblots assessing the entire molecular weight range of 14 to 211 kD. gp41 revealed a single band at 41 kD only in HIV-1 -infected tissue. Bands were scanned (Molecular Dynamics), and relative ratios of the intensity of the bands to that of trie β-tubulin band were calculated.
64. S. M. Toggas et al., Nature 367, 188 (1994); J. M. Hill et al., Brain Res. 603, 222 (1993).
65. S. M. Toggas et al., Nature 367, 188 (1994); J. M. Hill et al., Brain Res. 603, 222 (1993).
66. D. C. Adamson, J. D. Glass, J. C. McArthur, T. M. Dawson, V. L. Dawson, unpublished observations.
67. 2, humidified, 37°C incubator. The growth medium was supplement-ed with 10 μl of 2M glucose twice per week during the course of the experiment. Toxicity was assayed 7 days after initiation of exposure to the appropriate protein by trypan blue exclusion (0.4% trypan blue in CSS) as described (72). At least two separate experiments with four separate wells were performed, with a minimum of 4000 to 12,000 neurons counted per data point. The data were collected by an observer blinded to the treatment protocol. After 7 days, 400 μl of media was removed for colorimetric analysis of nitrite formation and added to 400 μl of Greiss reagent containing 4.25% phosphoric acid, 9.7 μM D-naphthyl ethylenediamine, and 0.14 mM sulfanilic acid. The samples were vortexed and after 5 to 10 min were read on a spectrophotometer at an absorbance of 563, The sample concentration was determined against a nitrite standard curve. For immunoblot analysis of iNOS, equivalent amounts of cell lysate prepared from the culture cells were loaded on a 5% SDS-PAGE gel (Bio-Rad, Hercules, CA) in tris-glycine buffer under reducing conditions and were further assessed as described for INOS and β-tubulin assessment in cortical brain tissue.
68. 2, humidified, 37°C incubator. The growth medium was supplement-ed with 10 μl of 2M glucose twice per week during the course of the experiment. Toxicity was assayed 7 days after initiation of exposure to the appropriate protein by trypan blue exclusion (0.4% trypan blue in CSS) as described (72). At least two separate experiments with four separate wells were performed, with a minimum of 4000 to 12,000 neurons counted per data point. The data were collected by an observer blinded to the treatment protocol. After 7 days, 400 μl of media was removed for colorimetric analysis of nitrite formation and added to 400 μl of Greiss reagent containing 4.25% phosphoric acid, 9.7 μM D-naphthyl ethylenediamine, and 0.14 mM sulfanilic acid. The samples were vortexed and after 5 to 10 min were read on a spectrophotometer at an absorbance of 563, The sample concentration was determined against a nitrite standard curve. For immunoblot analysis of iNOS, equivalent amounts of cell lysate prepared from the culture cells were loaded on a 5% SDS-PAGE gel (Bio-Rad, Hercules, CA) in tris-glycine buffer under reducing conditions and were further assessed as described for INOS and β-tubulin assessment in cortical brain tissue.
69. 2, humidified, 37°C incubator. The growth medium was supplement-ed with 10 μl of 2M glucose twice per week during the course of the experiment. Toxicity was assayed 7 days after initiation of exposure to the appropriate protein by trypan blue exclusion (0.4% trypan blue in CSS) as described (72). At least two separate experiments with four separate wells were performed, with a minimum of 4000 to 12,000 neurons counted per data point. The data were collected by an observer blinded to the treatment protocol. After 7 days, 400 μl of media was removed for colorimetric analysis of nitrite formation and added to 400 μl of Greiss reagent containing 4.25% phosphoric acid, 9.7 μM D-naphthyl ethylenediamine, and 0.14 mM sulfanilic acid. The samples were vortexed and after 5 to 10 min were read on a spectrophotometer at an absorbance of 563, The sample concentration was determined against a nitrite standard curve. For immunoblot analysis of iNOS, equivalent amounts of cell lysate prepared from the culture cells were loaded on a 5% SDS-PAGE gel (Bio-Rad, Hercules, CA) in tris-glycine buffer under reducing conditions and were further assessed as described for INOS and β-tubulin assessment in cortical brain tissue.
70. D. C. Adamson, T. M. Dawson, V. L. Dawson, unpublished observations.
71. D. C. Adamson, C. M. Zink, J. E. Clements, T. M. Dawson, V. L. Dawson, unpublished observations; T. E. Lane, M. J. Buchmeier, B. B. Watry, H. S. Fox, Mol. Med. 2, 27 (1996).
72. D. C. Adamson, C. M. Zink, J. E. Clements, T. M. Dawson, V. L. Dawson, unpublished observations; T. E. Lane, M. J. Buchmeier, B. B. Watry, H. S. Fox, Mol. Med. 2, 27 (1996).
73. L. Bo et al., Ann. Neurol. 36, 778 (1994); M.-L Wong et al., Nature Med. 2, 581 (1996).
74. L. Bo et al., Ann. Neurol. 36, 778 (1994); M.-L Wong et al., Nature Med. 2, 581 (1996).
75. C, Powers et al., J. Virol. 68, 4643 (1994). Demented and nondemented patients with AIDS differ in brain-derived HIV-1 envelope sequences.
76. The authors thank S. H. Snyder and R. T. Johnson for insightful critiques and discussion. A. Schmidt for secretarial assistance, and T. Billiar for the human iNOS cDNA. Supported in part by the following grants from the USPHS: NS07392 (D.C.A.), NS22643 (J.D.G., J.C.M., V.L.D., and T.M.D.), A135042 (J.C.M.), RR007222 (J.C.M.), and Clinical Investigator Development Awards NS01577 (J.D.G.) and NS01578 (T.M.D.). V.L.D. is also supported by the American Foundation for AIDS Research; J. C. M. by the Charles A. Dana Foundation; and T.M.D. by the American Health Assistance Foundation, International Life Sciences Institute, and a Paul Beeson Physicians Scholars in Aging Research Award.