Plasmodium hemozoin formation mediated by histidine-rich proteins

Science

Volumn 271, Issue 5246, 1996, Pages 219-222

  Sullivan Jr , David J ^a   Gluzman, Ilya Y ^a   Goldberg, Daniel E ^a  

^a BARNES JEWISH HOSPITAL   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

ANTIMALARIAL AGENT; CHLOROQUINE; HEME DERIVATIVE; HEMOGLOBIN; HISTIDINE;

ARTICLE; CELL VACUOLE; DIGESTION; DRUG ACCUMULATION; NONHUMAN; PLASMODIUM; POLYMERIZATION; PRIORITY JOURNAL; PROTEIN DEGRADATION;

EID: 0030045312     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.271.5246.219     Document Type: Article

References (47)

1. D E. Goldberg, Semin. Cell Biol. 4, 355 (1993).
2. P L. Olliaroand D E. Goldberg, Parasitol, Today 11, 294 (1995).
3. L W. Scheibel and I. W. Sherman, in Malaria, W. Wemsdorfer and I. McGregor, Eds. (Churchill Livingston, London, 1988), pp. 219-252
4. A F. G Slater et al, Proc Natl. Acad. Sci. U.S A. 88, 325 (1991).
5. A F. G. Slater and A. Cerami, Nature 355, 167 (1992), A C. Chou and C. D. Fitch, Life Sci 51, 2073 (1992)
6. A F. G. Slater and A. Cerami, Nature 355, 167 (1992), A C. Chou and C. D. Fitch, Life Sci 51, 2073 (1992)
7. T. J Egan, D. C. Ross, P A. Adams, FEBS Lett. 352, 54 (1994).
8. A Dom, R. Stoffel, H. Matile, A. Bubendorf, R. G. Ridley, Nature 374, 269 (1995).
9. A. U. Orjih, H. S. Banyal, R. Chevli, C. D. Fitch, Science 214, 667 (1981); C. D. Fitch et al., Antimicrob Agents Chemother. 21, 819 (1982).
10. A. U. Orjih, H. S. Banyal, R. Chevli, C. D. Fitch, Science 214, 667 (1981); C. D. Fitch et al., Antimicrob Agents Chemother. 21, 819 (1982).
11. D. L Vander Jagt, L A. Hunsaker, N. M Campos, Mol. Biochem. Parasitol. 18, 389 (1986); I. Y. Gluzman et al., J. Clin. Invest 93, 1602 (1994).
12. D. L Vander Jagt, L A. Hunsaker, N. M Campos, Mol. Biochem. Parasitol. 18, 389 (1986); I. Y. Gluzman et al., J. Clin. Invest 93, 1602 (1994).
13. A C Chou, R. Chevli, C. D. Fitch, Biochemistry 19, 1543 (1980)
14. D. J Sullivan Jr. and D. E. Goldberg, in preparation
15. R. J Howard et al., J. Cell Biol. 103, 1269 (1986)
16. M. Parra, C. Evans, D Taylor, J. Clin. Microbiol. 29, 1629 (1991); C Shift, Z. Premji, J Minjas, Trans, R. Soc Trop Med. Hyg. 87, 646 (1993)
17. M. Parra, C. Evans, D Taylor, J. Clin. Microbiol. 29, 1629 (1991); C Shift, Z. Premji, J Minjas, Trans, R. Soc Trop Med. Hyg. 87, 646 (1993)
18. T E. Wellems and R. J. Howard, Proc, Natl. Acad. Sci. U.S A 83, 6065 (1986); H. D. Stahl et al , Nucleic Acids Res. 13, 7837 (1985).
19. T E. Wellems and R. J. Howard, Proc, Natl. Acad. Sci. U.S A 83, 6065 (1986); H. D. Stahl et al , Nucleic Acids Res. 13, 7837 (1985).
20. M. Katagin, K. Tsutsui, T Yamano, Y Shimontshi, F. Ishibashi, Biochem. Biophys. Res Commun 149, 1070 (1987), M. Burch and W Morgan, Biochemistry 24, 5919 (1985); W Morgan, ibid, p 1496.
21. M. Katagin, K. Tsutsui, T Yamano, Y Shimontshi, F. Ishibashi, Biochem. Biophys. Res Commun 149, 1070 (1987), M. Burch and W Morgan, Biochemistry 24, 5919 (1985); W Morgan, ibid, p 1496.
22. M. Katagin, K. Tsutsui, T Yamano, Y Shimontshi, F. Ishibashi, Biochem. Biophys. Res Commun 149, 1070 (1987), M. Burch and W Morgan, Biochemistry 24, 5919 (1985); W Morgan, ibid, p 1496.
23. T. Koide, D. Foster, S. Yoshitake, E. W. Davie, Biochemistry 25, 2220 (1986).
24. F.W Studier, A H. Rosenberg, J. J. Dunn, Methods Enzymol 185, 60 (1990)
25. L. J. Panton et al., Mol. Biochem. Parasitol. 35, 149 (1989)
26. L Pologe and J. Ravetch, Cell 55, 869 (1988).
27. T. Wellems, A Walker-Jonah, L. Panton, Proc. Natl. Acad. Sci U S.A. 88, 3382 (1991); A. Walker-Jonah, S. Dolan, R. Gwadz, L Panton, T. Wellems, Mol. Biochem Parasitol. 51, 313(1992).
28. T. Wellems, A Walker-Jonah, L. Panton, Proc. Natl. Acad. Sci U S.A. 88, 3382 (1991); A. Walker-Jonah, S. Dolan, R. Gwadz, L Panton, T. Wellems, Mol. Biochem Parasitol. 51, 313(1992).
29. R. Lenstra, L. d'Aunol, B. Andneu, J. Le Bras, F. Galibert, Biochem. Biophys. Res. Commun. 146, 368 (1987).
30. L. H. Miller, M. F. Good, G. Milon, Science 264, 1878 (1994); H Muller et al., EMBO J. 12, 2881 (1993).
31. L. H. Miller, M. F. Good, G. Milon, Science 264, 1878 (1994); H Muller et al., EMBO J. 12, 2881 (1993).
32. D. Baruch et al., Cell 82, 77 (1995); J. Smith et al., ibid., p. 101.
33. D. Baruch et al., Cell 82, 77 (1995); J. Smith et al., ibid., p. 101.
34. X. Su et al., ibid., p. 89.
35. E. Schwarzer et al., J. Exp. Med. 176, 1033 (1992).
36. D. E. Goldberg, A F. G. Slater, A. Cerami, G. B. Henderson, Proc. Natl. Acad Sci. U.S.A. 87, 2931 (1990).
37. U. K. Laemmli, Nature 227, 680 (1970).
38. E. Harlow and D. Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988).
39. E. P. Rock et al., Parasitology 95, 209 (1987).
40. A. F. Cowman, S. Karcz, D. Galatis, J. G. Cutvenor, J. Cell Biol. 113, 1033 (1991). The technique was modified by extending acetone fixation to 5 min for vacuoles and 20 min for trophozortes.
41. A 10 mM fresh stock solution of hemin (Sigma) in 0.1 N NaOH was prepared. Protein samples were assayed for hemozoin formation by incubation for 12 to 16 hours in a final volume of 1 ml with 600 mM sodium acetate (pH 4.8) and 50 nmol of hemin. After incubation, 10 μl 10% SDS was added and the tubes were vortexed. After centnfugation at 15,000g for 1 hour the pellets were resuspended in 1.5 ml of 2.5% SDS and 0.1 M sodium bicarbonate (pH 9 1). The SDS and sodium bicarbonate solubilized heme, whereas hemozoin remained insoluble. The pellet was sonicated on the lowest setting for 10 s, with care taken to sonicate the sides of the tube, where hemozoin is adherent. After 5 min, the suspension was vortexed and then centrifuged for 1 hour. The pellet was suspended in 1.5 ml of 2.5% SDS and sonicated as above. After 5 min, the tubes were vortexed and centrifuged at 15,00og for 1 hour. The remaining pellet was suspended in 1 ml of 2.5% SDS for qualitative spectral analysis. To quantitate, we added 20 mM NaOH and measured absorbance at 400 nm (5) on a Beckmann DU-64 spectrophotometer. A range of concentrations from 10 to 1000 pmol of alternative proteins [BSA and lysozyme, Boehringer-Mannheim; polyasparagine, polytysine, and polyhistidine, Sigma; human HRG, see (33)] was also assessed for hemozoin production
42. + human erythrocytes at 2% hemocrit, using RPMI 1640 medium with 10% human serum [W. Trager and J. B. Jensen, Science 193, 673 (1976)]. Extracellular medium was collected after 12 hours of incubation. Imidazole was added to a concentration of 50mM, and the culture medium was processed over a 2-ml nickel column, as with recomibinant HRP II. Native HRP 111 was obtained from infected red blood cell lysates of clone Dd2 and processed as above, except that the nickel column was washed with 100 mM imidazoie before elution
43. + human erythrocytes at 2% hemocrit, using RPMI 1640 medium with 10% human serum [W. Trager and J. B. Jensen, Science 193, 673 (1976)]. Extracellular medium was collected after 12 hours of incubation. Imidazole was added to a concentration of 50mM, and the culture medium was processed over a 2-ml nickel column, as with recomibinant HRP II. Native HRP 111 was obtained from infected red blood cell lysates of clone Dd2 and processed as above, except that the nickel column was washed with 100 mM imidazoie before elution
44. Human HRG was extracted from serum by passage over a nickel column, as described (78). It was eluted with 200 mM imidazole and was dialyzed against water for 48 hours with three changes.
45. Recombinant HRP II (100 pmol) was incubated for 14 hours with 600 nmol of hemin in 500 mM sodium acetate (final volume, 12 ml). Insoluble material was collected by centrifugation as above, and was processed by washing in 2.5% SDS and 0.1 M sodium bicarbonate, then in 2.5% SDS, and finally three times in water Isolation of parasite hemozoin and production of β-hematin were as described (4). After lyophilization, each pellet was placed on a sodium chloride disk, and data were acquired for five cycles on a FTIR spectrometer (Perkin-Elmer 1710).
46. RNA was isolated from P fataparum clone 3B-D5 trophozoites [K A. Creedon, P K Rathod, T. E Wellems, J Biol Chem. 269, 16364 (1994)] and was reverse-transcribed after extensive deoxynbonuclease digestion (24). The HRP IV-specific sequence GTAATAGTCCAAAAAGATATTG was used as a primer. This ollgonucteotide and one corresponding to the downstream sequence CATCAAATTCTTCTAAGCC were used for polymerase chain reaction amplification; products were analyzed on a 1.3% agarose gel A control incubation, taken through the same steps but omitting reverse transcriptase, was performed; a band of the predicted size was found from the reverse transcnptase incubation only. Similar reactions with nested pnmers also gave bands of the predicted size.
47. We thank D. Taytor for mAbs, T. Weliems for Plasmodium clones 3B-D5 and Dd2, D. Covey for help with FTIR analysis, T. Steinberg for fluorescence microscope use, K Luker for advice on amino acid analysis, A. Oksman for parasite culture, and S. Francis and D. Minning for critical reading of the manuscript. Supported by NIH grant Al-31615. D.E.G. is a Charles E. Culpeper Medical Scholar.