In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector

Science

Volumn 272, Issue 5259, 1996, Pages 263-267

  Naldini, Luigi ^a   Blömer, Ulrike ^a   Gallay, Philippe ^a   Ory, Daniel ^b   Mulligan, Richard ^b   Gage, Fred H ^a   Verma, Inder M ^a   Trono, Didier ^a  

^a SALK INSTITUTE FOR BIOLOGICAL STUDIES   (United States)

^b WHITEHEAD INSTITUTE FOR BIOMEDICAL RESEARCH   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

ANIMAL CELL; ARTICLE; CELL CYCLE; CONTROLLED STUDY; EXPRESSION VECTOR; FIBROBLAST; GENE TARGETING; GENE THERAPY; GENE TRANSFER; GENETIC TRANSDUCTION; HELA CELL; HUMAN; HUMAN CELL; HUMAN IMMUNODEFICIENCY VIRUS; LENTIVIRINAE; MACROPHAGE; MURINE LEUKEMIA VIRUS; NERVE CELL; NONHUMAN; PRIORITY JOURNAL; RAT;

EID: 0029996147     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.272.5259.263     Document Type: Article

References (75)

1. I. M. Verma, Mol Med 1, 2 (1994): R. C. Mulligan, Science 260, 926 (1993); R. G Crystal, ibid 270, 404 (1995); J. M Leiden, N. Engl J. Med. 333, 871 (1995); R. Sanders Williams, Nature Med. 1, 1137 (1995)
2. I. M. Verma, Mol Med 1, 2 (1994): R. C. Mulligan, Science 260, 926 (1993); R. G Crystal, ibid 270, 404 (1995); J. M Leiden, N. Engl J. Med. 333, 871 (1995); R. Sanders Williams, Nature Med. 1, 1137 (1995)
3. I. M. Verma, Mol Med 1, 2 (1994): R. C. Mulligan, Science 260, 926 (1993); R. G Crystal, ibid 270, 404 (1995); J. M Leiden, N. Engl J. Med. 333, 871 (1995); R. Sanders Williams, Nature Med. 1, 1137 (1995)
4. I. M. Verma, Mol Med 1, 2 (1994): R. C. Mulligan, Science 260, 926 (1993); R. G Crystal, ibid 270, 404 (1995); J. M Leiden, N. Engl J. Med. 333, 871 (1995); R. Sanders Williams, Nature Med. 1, 1137 (1995)
5. I. M. Verma, Mol Med 1, 2 (1994): R. C. Mulligan, Science 260, 926 (1993); R. G Crystal, ibid 270, 404 (1995); J. M Leiden, N. Engl J. Med. 333, 871 (1995); R. Sanders Williams, Nature Med. 1, 1137 (1995)
6. A D. Miller, D. G. Miller, J. V. Garcia, C M. Lynch, Methods Enzymol. 217, 581 (1993)
7. D G Miller, M. A Adam, A D Miller, Mol. Cell. Biol. 10, 4239 (1990).
8. T. Roe, T. C. Reynolds, G. Yu, P. O. Brown, EMBO J. 12, 2099 (1993), P. F. Lewis and M. Emerman, J. Virol 68, 510 (1994).
9. T. Roe, T. C. Reynolds, G. Yu, P. O. Brown, EMBO J. 12, 2099 (1993), P. F. Lewis and M. Emerman, J. Virol 68, 510 (1994).
10. J. B. Weinberg, T. J. Matthews, B. R. Cullen, M. H. Malim, J. Exp. Med. 174, 1477 (1991).
11. P. Lewis, M. Hensel, M. Emerman, EMBO J 11, 3053 (1992).
12. M. I. Bukrinsky et al., Nature 365, 666 (1993), N. K. Heinzinger et al , Proc. Natl. Acad. Sci U.S.A. 91, 7311 (1994).
13. M. I. Bukrinsky et al., Nature 365, 666 (1993), N. K. Heinzinger et al , Proc. Natl. Acad. Sci U.S.A. 91, 7311 (1994).
14. U von Schwedler, R. S. Kornbluth, D. Trono, Proc. Natl. Acad. Sci. U.S.A. 91, 6992 (1994).
15. P. Gallay, S Swingler, C Aiken, D. Trono, Cell 80, 379 (1995), P. Gallay, S. Swingler, J. Song, F Bushman, D. Trono, ibid. 83, 569 (1995); P. Gallay, V. Stitt, C. Mundy, M Oettinger, D. Trono, J. Virol. 70, 1027 (1996).
16. P. Gallay, S Swingler, C Aiken, D. Trono, Cell 80, 379 (1995), P. Gallay, S. Swingler, J. Song, F Bushman, D. Trono, ibid. 83, 569 (1995); P. Gallay, V. Stitt, C. Mundy, M Oettinger, D. Trono, J. Virol. 70, 1027 (1996).
17. P. Gallay, S Swingler, C Aiken, D. Trono, Cell 80, 379 (1995), P. Gallay, S. Swingler, J. Song, F Bushman, D. Trono, ibid. 83, 569 (1995); P. Gallay, V. Stitt, C. Mundy, M Oettinger, D. Trono, J. Virol. 70, 1027 (1996).
18. N R. Landau and D. R. Littman, J. Virol 66, 5110 (1992); W. S. Pear, G. P. Nolan, M. L. Scott, D. Baltimore, Proc. Natl. Acad. Sci. U S.A. 90, 8392 (1993), M H Finer, T. J Dull, L. Qin, D. Farson, M. R. Roberts, Blood 83, 43 (1994); Y. Soneoka et al., Nucleic Acids Res. 23, 628 (1995).
19. N R. Landau and D. R. Littman, J. Virol 66, 5110 (1992); W. S. Pear, G. P. Nolan, M. L. Scott, D. Baltimore, Proc. Natl. Acad. Sci. U S.A. 90, 8392 (1993), M H Finer, T. J Dull, L. Qin, D. Farson, M. R. Roberts, Blood 83, 43 (1994); Y. Soneoka et al., Nucleic Acids Res. 23, 628 (1995).
20. N R. Landau and D. R. Littman, J. Virol 66, 5110 (1992); W. S. Pear, G. P. Nolan, M. L. Scott, D. Baltimore, Proc. Natl. Acad. Sci. U S.A. 90, 8392 (1993), M H Finer, T. J Dull, L. Qin, D. Farson, M. R. Roberts, Blood 83, 43 (1994); Y. Soneoka et al., Nucleic Acids Res. 23, 628 (1995).
21. N R. Landau and D. R. Littman, J. Virol 66, 5110 (1992); W. S. Pear, G. P. Nolan, M. L. Scott, D. Baltimore, Proc. Natl. Acad. Sci. U S.A. 90, 8392 (1993), M H Finer, T. J Dull, L. Qin, D. Farson, M. R. Roberts, Blood 83, 43 (1994); Y. Soneoka et al., Nucleic Acids Res. 23, 628 (1995).
22. Briefly, plasmid pCMVΔR9 was constructed from an env-defective version of pR9, an infectious molecular clone of proviral HIV-1 DNA made by cloning the Bss HII-Bam HI fragment of NL4.3 in pR7, with insertion of a Mlu I linker at the Stu I site that frameshifts the env reading frame [D. Trono, M. B. Feinberg, D Baltimore, Cell 59, 113 (1989)]. A 39-base pair (bp) internal deletion in the ψ sequence (12) was introduced, and the 3′ HIV long terminal repeat (LTR) was replaced with the poly(A) site of insulin genomic DNA. The 5′ LTR and leader sequences of HIV were substituted with a 0.8-kbp fragment containing the CMV promoter.
23. A. Lever, H. Gottlinger, W. Haseltine, J. Sodroski, J. Virol. 63, 4085 (1989),
24. A. Aldovini and R. A. Young, ibid 64, 1920 (1990); J. Luban and S P Goff, ibid. 68, 3784 (1994); H.-J. Kim, K Lee, J. J. O'Rear, Virology 198, 336 (1994); E. Vicenzi et al., J Virol. 68, 7879 (1994).
25. A. Aldovini and R. A. Young, ibid 64, 1920 (1990); J. Luban and S P Goff, ibid. 68, 3784 (1994); H.-J. Kim, K Lee, J. J. O'Rear, Virology 198, 336 (1994); E. Vicenzi et al., J Virol. 68, 7879 (1994).
26. A. Aldovini and R. A. Young, ibid 64, 1920 (1990); J. Luban and S P Goff, ibid. 68, 3784 (1994); H.-J. Kim, K Lee, J. J. O'Rear, Virology 198, 336 (1994); E. Vicenzi et al., J Virol. 68, 7879 (1994).
27. A. Aldovini and R. A. Young, ibid 64, 1920 (1990); J. Luban and S P Goff, ibid. 68, 3784 (1994); H.-J. Kim, K Lee, J. J. O'Rear, Virology 198, 336 (1994); E. Vicenzi et al., J Virol. 68, 7879 (1994).
28. P. Lusso et al., Science 247, 848 (1990); D. H Spector et al., J. Virol. 64, 2298 (1990); N. R Landau, K. A Page, D. R. Littman, ibid. 65, 162 (1991)
29. P. Lusso et al., Science 247, 848 (1990); D. H Spector et al., J. Virol. 64, 2298 (1990); N. R Landau, K. A Page, D. R. Littman, ibid. 65, 162 (1991)
30. P. Lusso et al., Science 247, 848 (1990); D. H Spector et al., J. Virol. 64, 2298 (1990); N. R Landau, K. A Page, D. R. Littman, ibid. 65, 162 (1991)
31. Plasmid pSV-A-MLV-env [K. A. Page, N. R. Landau, D R. Littman, J. Virol. 64, 5270 (1990)] encodes the amphotropic envelope of the 4070 Moloney leukemia virus under the transcriptional control of the MLV LTR. Plasmid pMD.G encodes the envelope protein G of the vesicular stomatitis virus under the transcriptional control of the CMV promoter.
32. J C. Burns, T. Friedman, W. Driever, M. Burrascano, J.-K. Yee, Proc. Natl. Acad. Sci. U S A 90, 8033 (1993), J.-K Yee et al., ibid. 91, 9564 (1994)
33. J C. Burns, T. Friedman, W. Driever, M. Burrascano, J.-K. Yee, Proc. Natl. Acad. Sci. U S A 90, 8033 (1993), J.-K Yee et al., ibid. 91, 9564 (1994)
34. Plasmid pHR′ was constructed by cloning a fragment of the env gene encompassing the RRE and a splice acceptor site between the two LTRs of the HIV-1 proviral DNA. The gag gene was truncated and its reading frame blocked by a frameshift mutation pHR′-CMVLacZ was generated by cloning a 3.6-kbp Sal I-Xho I fragment containing the CMV promoter and the E. coli lacZ gene (encoding β-gal) from plasmid pSLX-CMVLacZ (20). pHR′-CMVLucif was made by replacing a Bam HI-Xho I fragment in pHR′-CMVLacZ, containing the lacZ gene, with a 1 7-kbp Bam HI-Xho I fragment from pGFM-luc (Promega) containing the firefly luciferase gene
35. G. L J Buchschacher and A T. Panganiban, J. Virol. 66, 2731 (1992), J. H. Richardson, L. A. Child, A. M L. Lever, ibid. 67, 3997 (1993); C. Parolin, T. Dorfman, G. Palú, H. Gottlinger, J. Sodroski, ibid 68, 3888 (1994), J. H. Richardson, J. F. Kaye, L A. Child, A. M. L. Lever, J. Gen. Virol. 76, 691 (1995); R D. Berkowitz, M.-L. Hammarskjöld, C Helga-Maria, D. Rekosh, S. P Goff, Virology 212, 718 (1995) , J. F Kaye, J. H Richardson, A M L Lever, J Virol. 69, 6588 (1995).
36. G. L J Buchschacher and A T. Panganiban, J. Virol. 66, 2731 (1992), J. H. Richardson, L. A. Child, A. M L. Lever, ibid. 67, 3997 (1993); C. Parolin, T. Dorfman, G. Palú, H. Gottlinger, J. Sodroski, ibid 68, 3888 (1994), J. H. Richardson, J. F. Kaye, L A. Child, A. M. L. Lever, J. Gen. Virol. 76, 691 (1995); R D. Berkowitz, M.-L. Hammarskjöld, C Helga-Maria, D. Rekosh, S. P Goff, Virology 212, 718 (1995) , J. F Kaye, J. H Richardson, A M L Lever, J Virol. 69, 6588 (1995).
37. G. L J Buchschacher and A T. Panganiban, J. Virol. 66, 2731 (1992), J. H. Richardson, L. A. Child, A. M L. Lever, ibid. 67, 3997 (1993); C. Parolin, T. Dorfman, G. Palú, H. Gottlinger, J. Sodroski, ibid 68, 3888 (1994), J. H. Richardson, J. F. Kaye, L A. Child, A. M. L. Lever, J. Gen. Virol. 76, 691 (1995); R D. Berkowitz, M.-L. Hammarskjöld, C Helga-Maria, D. Rekosh, S. P Goff, Virology 212, 718 (1995) , J. F Kaye, J. H Richardson, A M L Lever, J Virol. 69, 6588 (1995).
38. G. L J Buchschacher and A T. Panganiban, J. Virol. 66, 2731 (1992), J. H. Richardson, L. A. Child, A. M L. Lever, ibid. 67, 3997 (1993); C. Parolin, T. Dorfman, G. Palú, H. Gottlinger, J. Sodroski, ibid 68, 3888 (1994), J. H. Richardson, J. F. Kaye, L A. Child, A. M. L. Lever, J. Gen. Virol. 76, 691 (1995); R D. Berkowitz, M.-L. Hammarskjöld, C Helga-Maria, D. Rekosh, S. P Goff, Virology 212, 718 (1995) , J. F Kaye, J. H Richardson, A M L Lever, J Virol. 69, 6588 (1995).
39. G. L J Buchschacher and A T. Panganiban, J. Virol. 66, 2731 (1992), J. H. Richardson, L. A. Child, A. M L. Lever, ibid. 67, 3997 (1993); C. Parolin, T. Dorfman, G. Palú, H. Gottlinger, J. Sodroski, ibid 68, 3888 (1994), J. H. Richardson, J. F. Kaye, L A. Child, A. M. L. Lever, J. Gen. Virol. 76, 691 (1995); R D. Berkowitz, M.-L. Hammarskjöld, C Helga-Maria, D. Rekosh, S. P Goff, Virology 212, 718 (1995) , J. F Kaye, J. H Richardson, A M L Lever, J Virol. 69, 6588 (1995).
40. G. L J Buchschacher and A T. Panganiban, J. Virol. 66, 2731 (1992), J. H. Richardson, L. A. Child, A. M L. Lever, ibid. 67, 3997 (1993); C. Parolin, T. Dorfman, G. Palú, H. Gottlinger, J. Sodroski, ibid 68, 3888 (1994), J. H. Richardson, J. F. Kaye, L A. Child, A. M. L. Lever, J. Gen. Virol. 76, 691 (1995); R D. Berkowitz, M.-L. Hammarskjöld, C Helga-Maria, D. Rekosh, S. P Goff, Virology 212, 718 (1995) , J. F Kaye, J. H Richardson, A M L Lever, J Virol. 69, 6588 (1995).
41. L. Naldini et al., unpublished data.
42. A total of 40 μg of plasmid DNA was used for the transfection of a 10-cm-diameter plate of 293T cells in the following proportions. 10 μg of pCMVΔR9, 20 μg of pHR′, and 10 μg of env plasmid, as described [C. Chen and H. Okayama, Mol. Cell. Biol 7, 2745 (1987)]. Conditioned medium was harvested 48 to 60 hours after transfection, subjected to low-speed centrifugation, filtered through 0.45-μm filters, and assayed for p24 Gag antigen by enzyme-linked immunosorbent assay (ELISA) (DuPont). The average vector yield was 50 to 80 ng of p24 per milliliter.
43. MLV-based vectors were produced from transient transfection in 293T cells of the following plasmids pSLX-CMVLacZ [R. Scharfmann, J. H. Axelrod, I. M. Verma, Proc. Natl. Acad. Sci. U.S.A. 88, 4626 (1991)] is a MLV-derived vector carrying a hCMV-driven E. coli lacZ gene. The pCL plasmid series carries a hybrid CMV-LTR promoter that allows for CMV-driven transcription in the packaging cell and reconstitution of a functional LTR in the target cell ( R. Naviaux, E Costanzi, M Haas, I. Verma, in preparation). The luciferase gene was cloned in vector pCLNCX, creating pCLNCLuc. MLV-based vectors with the cognate MLV (Ampho) envelope were produced by the cotransfection of either of the vector plasmids with the amphotropic packaging plasmid pCL-Ampho. VSV G-pseudotyped vectors were produced by the cotransfection of either of the vector plasmids with the MLV gag-pol packaging plasmid pCMV-GAGPOL and the VSV G plasmid.
44. MLV-based vectors were produced from transient transfection in 293T cells of the following plasmids pSLX-CMVLacZ [R. Scharfmann, J. H. Axelrod, I. M. Verma, Proc. Natl. Acad. Sci. U.S.A. 88, 4626 (1991)] is a MLV-derived vector carrying a hCMV-driven E. coli lacZ gene. The pCL plasmid series carries a hybrid CMV-LTR promoter that allows for CMV-driven transcription in the packaging cell and reconstitution of a functional LTR in the target cell ( R. Naviaux, E Costanzi, M Haas, I. Verma, in preparation). The luciferase gene was cloned in vector pCLNCX, creating pCLNCLuc. MLV-based vectors with the cognate MLV (Ampho) envelope were produced by the cotransfection of either of the vector plasmids with the amphotropic packaging plasmid pCL-Ampho. VSV G-pseudotyped vectors were produced by the cotransfection of either of the vector plasmids with the MLV gag-pol packaging plasmid pCMV-GAGPOL and the VSV G plasmid.
45. 2, and assaying a 50-μl sample for luminescence in a luminometer. The HIV-based luciferase vector transduced 930 ± 240 (n = 4) relative luminescence units (RLU) per microliter of infected transfectant-conditioned medium with VSV envelope, and 460 ± 110 (n = 2) RLU with MLV (Ampho) envelope. MLV-based luciferase vector pseudotyped with VSV envelope transduced 920 RLU/μl.
46. M. Poznansky, A. Lever, L. Bergeron, W. Haseltine, J. Sodroski, J. Virol 65, 532 (1991); T. Shimada, H. Fujii, H Mitsuya, A. W. Nienhuis, J. Clin. Invest. 88, 1043 (1991); R Carroll et al., J. Virol 68, 6047 (1994).
47. M. Poznansky, A. Lever, L. Bergeron, W. Haseltine, J. Sodroski, J. Virol 65, 532 (1991); T. Shimada, H. Fujii, H Mitsuya, A. W. Nienhuis, J. Clin. Invest. 88, 1043 (1991); R Carroll et al., J. Virol 68, 6047 (1994).
48. M. Poznansky, A. Lever, L. Bergeron, W. Haseltine, J. Sodroski, J. Virol 65, 532 (1991); T. Shimada, H. Fujii, H Mitsuya, A. W. Nienhuis, J. Clin. Invest. 88, 1043 (1991); R Carroll et al., J. Virol 68, 6047 (1994).
49. M D Miller, M. T. Warmerdam, I. Gaston, W. C. Greens, M. B Feinberg, J. Exp. Med. 179, 101 (1994); C. A Spina, T. J. Kwoh, M. Y. Crowers, J. C. Guatelli, D. D Richman, ibid , p. 115, C Aiken and D. Trono, J. Virol. 69, 5048 (1995).
50. M D Miller, M. T. Warmerdam, I. Gaston, W. C. Greens, M. B Feinberg, J. Exp. Med. 179, 101 (1994); C. A Spina, T. J. Kwoh, M. Y. Crowers, J. C. Guatelli, D. D Richman, ibid , p. 115, C Aiken and D. Trono, J. Virol. 69, 5048 (1995).
51. M D Miller, M. T. Warmerdam, I. Gaston, W. C. Greens, M. B Feinberg, J. Exp. Med. 179, 101 (1994); C. A Spina, T. J. Kwoh, M. Y. Crowers, J. C. Guatelli, D. D Richman, ibid , p. 115, C Aiken and D. Trono, J. Virol. 69, 5048 (1995).
52. Presence of helper virus and transfer of the HIV tat gene were measured by inoculating HeLa P4 2 cells with HIV vector, pseudotyped or not with MLV (Ampho) envelope, and staining with X-Gal after 48 hours. P4.2 cells express CD4 and contain an integrated lacZ reporter gene driven by the HIV LTR [P. Chameau et al , J Mol Biol. 241, 651 (1994)]. Positive scoring indicated expression of the tat gene The detection limit of the assay was 20 tat-transducing units per milliliter of test medium For comparison, envelope-defective HIV viruses, pseudotyped or not with MLV (Ampho) envelope, were generated by transfecting plasmid pΔER9 in 293T cells. When normalized for p24 Gag antigen, MLV (Ampho)-pseudotyped HIV virus transduced Tat with an efficiency of 630 TU per nanogram of p24 Gag antigen, nonpseudotyped envelope-defective virus had a barely detectable activity of 0.023 TU per nanogram of p24, and no transduction of Tat was detected with a maximal dose tested of HIV vector corresponding to 1.2 μg of p24 Gag antigen, either with or without envelope. On the other hand, when assayed for the transduction of β-gal into naive HeLa cells, HIV vector pseudotyped with MLV (Ampho) envelope had an average efficiency of 115 TU per nanogram of p24 and of 940 TU/ng when pseudotyped with VSV G. Transfer of the HIV gag gene was assayed by measuring p24 Gag antigen in extracts of HeLa cultures serially passaged after infection with the viral equivalent of 1 μg of p24 of both MLV (Ampho)-pseudotyped HIV vector and virus. The detection limit was ≥ 1 pg per milliliter of extract. Cells infected with envelope-defective, pseudotyped HIV virus consistently gave readings above 20 ng/ml. No Gag antigen was detected in extracts of vector-transduced cells. The same held true when HeLa cells transduced with the pHR′-LacZ vector were selected for β-gal expression by live fluorescence-activated cell sorting after fluorescein-di-β-D-galactopyranoside (FDG) staining [G. P. Nolan, S Fiering, J.-F. Nicolas, L. A Herzenberg, Proc. Natl. Acad. Sci. U.S.A. 85, 2603 (1988)]. More than 65% of selected cells expressed the marker gene and were serially passaged Their supernatant scored negative both for p24 Gag content and for transfer of the lacZ gene to 208F fibroblasts.
53. Presence of helper virus and transfer of the HIV tat gene were measured by inoculating HeLa P4 2 cells with HIV vector, pseudotyped or not with MLV (Ampho) envelope, and staining with X-Gal after 48 hours. P4.2 cells express CD4 and contain an integrated lacZ reporter gene driven by the HIV LTR [P. Chameau et al , J Mol Biol. 241, 651 (1994)]. Positive scoring indicated expression of the tat gene The detection limit of the assay was 20 tat-transducing units per milliliter of test medium For comparison, envelope-defective HIV viruses, pseudotyped or not with MLV (Ampho) envelope, were generated by transfecting plasmid pΔER9 in 293T cells. When normalized for p24 Gag antigen, MLV (Ampho)-pseudotyped HIV virus transduced Tat with an efficiency of 630 TU per nanogram of p24 Gag antigen, nonpseudotyped envelope-defective virus had a barely detectable activity of 0.023 TU per nanogram of p24, and no transduction of Tat was detected with a maximal dose tested of HIV vector corresponding to 1.2 μg of p24 Gag antigen, either with or without envelope. On the other hand, when assayed for the transduction of β-gal into naive HeLa cells, HIV vector pseudotyped with MLV (Ampho) envelope had an average efficiency of 115 TU per nanogram of p24 and of 940 TU/ng when pseudotyped with VSV G. Transfer of the HIV gag gene was assayed by measuring p24 Gag antigen in extracts of HeLa cultures serially passaged after infection with the viral equivalent of 1 μg of p24 of both MLV (Ampho)-pseudotyped HIV vector and virus. The detection limit was ≥ 1 pg per milliliter of extract. Cells infected with envelope-defective, pseudotyped HIV virus consistently gave readings above 20 ng/ml. No Gag antigen was detected in extracts of vector-transduced cells. The same held true when HeLa cells transduced with the pHR′-LacZ vector were selected for β-gal expression by live fluorescence-activated cell sorting after fluorescein-di-β-D-galactopyranoside (FDG) staining [G. P. Nolan, S Fiering, J.-F. Nicolas, L. A Herzenberg, Proc. Natl. Acad. Sci. U.S.A. 85, 2603 (1988)]. More than 65% of selected cells expressed the marker gene and were serially passaged Their supernatant scored negative both for p24 Gag content and for transfer of the lacZ gene to 208F fibroblasts.
54. 2 [M. B. Kastan et al , Cell 71, 587 (1992)]. Similar results were obtained for all MOIs tested (from 0.001 to 1) and for the transduction of luciferase. Virtually all cells in a well could be transduced with MOI > 1 both when growing and when growth-arrested.
55. 2 [M. B. Kastan et al , Cell 71, 587 (1992)]. Similar results were obtained for all MOIs tested (from 0.001 to 1) and for the transduction of luciferase. Virtually all cells in a well could be transduced with MOI > 1 both when growing and when growth-arrested.
56. 2 [M. B. Kastan et al , Cell 71, 587 (1992)]. Similar results were obtained for all MOIs tested (from 0.001 to 1) and for the transduction of luciferase. Virtually all cells in a well could be transduced with MOI > 1 both when growing and when growth-arrested.
57. P Gallay and D Trono, unpublished data, M. A. Ansari-Lari, L. A Donehower, R. A. Gibbs, Virology 211, 332 (1995).
58. A. D. Leavitt, G. Rubles, N Alesandro, H. E. Varmus, J Virol. 70, 721 (1996).
59. Mutant packaging plasmids were constructed by substituting in pCMVΔR9 a Bcl I-Sal I cassette containing the mutations from plasmids pΔINR8 (9) and pHIV-Hygro-D64V (27). Although residual transducing activity was scored for the vector assembled from the packaging plasmid carrying the D64V integrase mutation, β-gal-positive cells showed on average significantly weaker staining than those transduced by the wild-type vector and were apparently unable to form foci of stably transduced cells. This is also consistent with the residual activity observed for the D64V integrase mutation in the context of the HIV-1 genome (27) and probably reflects expression from episomal DNA.
60. The fraction of cells in S phase was 40 to 50% in growing cells, and from 10 down to 2% after reaching confluence, depending on the elapsed time, as assayed by propidium iodide staining and flow cytometry (18).
61. o cells contained 592 ± 120 pg of p24 after incubation with pseudotyped vector, and 90 ± 15 pg of p24 after incubation with particles with no envelope.
62. J A Zack et al., Cell 61, 213 (1990); J A Zack, A M. Haislip, P. Krogstad, I S. Y. Chen, J. Virol. 66, 1717 (1992).
63. J A Zack et al., Cell 61, 213 (1990); J A Zack, A M. Haislip, P. Krogstad, I S. Y. Chen, J. Virol. 66, 1717 (1992).
64. A. Cohen, J. Barankiewica, H. M. Lederman, E W. Gelfand, J. Biol. Chem. 258, 12334 (1983); P. J. McCormick, L. L. Danhauser, Y M. Rustum, J. S. Bertram, Biochem. Biophys Res. Commun 755, 36 (1983); A. Meyerhans et al., J. Virol. 68, 535 (1994); H. Schuitemaker, N A. Koostra, R A. M. Fouchier, B. Hooibrink, F. Miedema, EMBO J. 13, 5929 (1994).
65. A. Cohen, J. Barankiewica, H. M. Lederman, E W. Gelfand, J. Biol. Chem. 258, 12334 (1983); P. J. McCormick, L. L. Danhauser, Y M. Rustum, J. S. Bertram, Biochem. Biophys Res. Commun 755, 36 (1983); A. Meyerhans et al., J. Virol. 68, 535 (1994); H. Schuitemaker, N A. Koostra, R A. M. Fouchier, B. Hooibrink, F. Miedema, EMBO J. 13, 5929 (1994).
66. A. Cohen, J. Barankiewica, H. M. Lederman, E W. Gelfand, J. Biol. Chem. 258, 12334 (1983); P. J. McCormick, L. L. Danhauser, Y M. Rustum, J. S. Bertram, Biochem. Biophys Res. Commun 755, 36 (1983); A. Meyerhans et al., J. Virol. 68, 535 (1994); H. Schuitemaker, N A. Koostra, R A. M. Fouchier, B. Hooibrink, F. Miedema, EMBO J. 13, 5929 (1994).
67. A. Cohen, J. Barankiewica, H. M. Lederman, E W. Gelfand, J. Biol. Chem. 258, 12334 (1983); P. J. McCormick, L. L. Danhauser, Y M. Rustum, J. S. Bertram, Biochem. Biophys Res. Commun 755, 36 (1983); A. Meyerhans et al., J. Virol. 68, 535 (1994); H. Schuitemaker, N A. Koostra, R A. M. Fouchier, B. Hooibrink, F. Miedema, EMBO J. 13, 5929 (1994).
68. Peripheral blood monocytes were prepared from the buffy coats of healthy donors as previously described (8) and cultured in RPMI containing 10% human serum for 2 to 4 weeks before infection. Cultures were infected without or with HIV-based and MLV-based luciferase vectors pseudotyped or not with VSV envelope. For the HIV-based vector, 150 ng of p24 equivalent were used per each inoculum
69. L Naldinin et al., data not shown
70. TTR7, in which two threonines (T) replace two lysines (K) in the NLS of MA. The construction and biological properties of these mutants have been described (8, 9). Occasionally, mutant vectors showed a less pronounced phenotype in the macrophages from one donor, perhaps because of variation in the state of growth arrest of the cells. High pressure liquid chromatography (HPLC)-purified peptides had the following sequence: PKKKRKVEDPYC (NLS peptide) and PDEVKRKKKPYC (reverse). Abbreviations for the amino acid residues are as follows. C, Cys; D, Asp; E, Glu; K. Lys; P, Pro; R, Arg; V, Val; and Y, Tyr
71. 8 TU/ml on 208F cells were obtained. All animal procedures were performed according to institution-approved protocols and in a biosafety level 3 environment. Adult female Fischer 344 rats were anesthetized [ketamine (44 mg per kilogram of body weight), acepromazine (0.75 mg/kg), and xylazine (4 mg/kg) in 0 9% NaCl, intraperitoneally], positioned in a stereotactic head frame, and slowly injected with 2 μl of vector stock into the striatum [anteroposterior (AP), +0.2; mediolateral (ML), ± 3.5; dorsoventral (DV), -4.5] and hippocampus (AP, -3.5, ML, 3.0; DV, -4.0) bilaterally. Seven or 30 days after injection the rats were deeply anesthetized and perfused with 4% cold paraformaldehyde and 0 2% glutaraldehyde intracardially. The brains were removed, postfixed 24 hours, saturated in 30% sucrose, and sectioned on a freezing microtome (40-μm sections) Light microscopy sections were stained with avidin-biotin peroxidase (Vectastain Elit, Vector Labs) and diammobenzidine. Immunofluorescence triple labeling was conducted with rabbit antibody to β-gal (anti-β-gal) (1:1000, Cortex), mouse monoclonal anti-NeuN (1:4), and guinea pig anti-GFAP (1.250, Advanced Immunochemical) Secondary antibodies coupled to fluorescent markers CY5, dichlorotriazinyl amino fluorescein, and Texas Red were used at 1.250 dilution. Slices were mounted with diazobicyclooctane/polyvinyl alcohol mounting medium and analyzed by confocal scanning laser microscopy (Bio-Rad MRTC600). Fluorescent signals were collected, digitally color-enhanced, and superimposed. False-color images were generated electronically with Adobe Photoshop (Adobe System).
72. R. J. Mullen, C R. Buck, A. M. Smith, Development 116, 201 (1992).
73. R. M. Knowles et al., W. Engl. J. Med. 333, 823 (1995).
74. HXB2D sequence, according to L. Ratner et al., Nature 313, 277 (1985), are indicated in parentheses] LTR5: GGCTAACTAGGGAACCCACTGCTT (496 to 516); LTR6; CTGCTAGAGATTTTCCACACTGAC (635 to 612); 5NC2; CCGAGTCCTGCGTCGAGAGAGC (698 to 677); LTR8: TCCCAGGCTCAGATCTGGTCTAAC (488 to 465 and 9572 to 9549); and LTR9 GCCTCAATAAAGCTTGCCTTG (522 to 542 and 9606 to 9626). LTR5 plus LTR6 amplifies minus-strand strong stop DNA, LTR5 plus 5NC2 amplifies double-stranded molecules generated after the second template switch, and LTR8 plus LTR9 amplifies two LTR circles. A series of logarithmic dilutions of pHR′ plasmid used as a template showed linearity of the PCR reaction over the early time points.
75. We are grateful to G. Nolan, A. Leavitt, and R J. Mullen for providing reagents; members of the Verma, Gage, and Trono laboratories for helpful suggestions; and J. Stevenson for critical reading of the manuscript. L N. is on leave from the Institute for Cancer Research, University of Torino Medical School, Torino, Italy, and was supported by the Italian Association for Cancer Research (A I R C) and currently by the American-Italian Cancer Foundation U.B. is supported by a fellowship from the Deutsche Forschungs-gemeinschaft, and P.G. from the Swiss National Science Foundation. This work is supported by grants from the NIH and American Cancer Society (I.M.V.); PHS award AI37510 (D T.); PHS awards AG10435 and AG08514 and Hollfelder Foundation (F.H.G.), and H. N. and Frances Berger Foundation (D.T., I M.V., and F.H.G.) I.M.V. is an American Cancer Society Professor of Molecular Biology and D.T. is a Pew Scholar. L.N. would like to dedicate this work to the memory of Mauro Naldini.