Sterol esterification in yeast: A two-gene process

Science

Volumn 272, Issue 5266, 1996, Pages 1353-1356

  Yang, Hongyuan ^a   Bard, Martin ^b   Bruner, Debora A ^b   Gleeson, Anne ^a   Deckelbaum, Richard J ^a   Aljinovic, Gordana ^c   Pohl, Thomas M ^c   Rothstein, Rodney ^a   Sturley, Stephen L ^a  

^a College of Physicians and Surgeons ^*  (United States)

^b INDIANA UNIVERSITY   (United States)

^c GATC Gesell F Analyse Technik C   (Germany)

Author keywords

[No Author keywords available]

Indexed keywords

ACETIC ACID; CHOLESTEROL ACYLTRANSFERASE; STEROL;

ARTICLE; CELL MEMBRANE; CELL VIABILITY; CONSENSUS SEQUENCE; CONTROLLED STUDY; ENZYME STRUCTURE; ESTERIFICATION; FUNGAL GENETICS; GENE DELETION; GENE DISRUPTION; NONHUMAN; PRIORITY JOURNAL; STEROL SYNTHESIS; YEAST;

EID: 0029950683     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.272.5266.1353     Document Type: Article

References (38)

1. T.-Y. Chang and G. M. Doolittle, in The Enzymes, P. Boyer, Ed. (Academic Press, New York, 1983), vol, XVI, p. 523.
2. K. E. Bloch, CRC Crit. Rev. Biochem. 14. 47 (1983).
3. M. P. Reinhart, J. T. Billheimer, J. R. Faust, J. L. Gaylor, J. Biol. Chem. 262, 9649 (1987).
4. X. Wang et al., Cell 77, 53 (1994).
5. J. T. Billheimer and P. J. Gillies, in Advances in Cholesterol Research, M Esfahani and J. B. Swaney, Eds. (Telford Press, Philadelphia, 1992).
6. T. P. Carr, J. S. Parks, L. L. Rudel, Arterioscler. Thromb. 12, 1275 (1992); S. C. Rumsey, N. F. Galeano, B. Lipschitz, R. J. Deckelbaum, J. Biol. Chem. 270, 10008 (1995).
7. T. P. Carr, J. S. Parks, L. L. Rudel, Arterioscler. Thromb. 12, 1275 (1992); S. C. Rumsey, N. F. Galeano, B. Lipschitz, R. J. Deckelbaum, J. Biol. Chem. 270, 10008 (1995).
8. T. Shiratori and D. S. Goodman, Biochim. Biophys. Acta 106, 625 (1965).
9. S. S. Katz, G. G, Shipley, D. M. Small, J. Clin. Invest. 58, 200 (1976).
10. C. C. Y, Chang, H. Y. Huh, K. M. Cadigan, T. Y. Chang, J. Biol. Chem. 268, 20747 (1993).
11. D. Cheng, C. C. Y. Chang, X. M. Qu, T. Y. Chang, ibid. 270, 685 (1995).
12. S. K. Erickson, S. R. Lear, M. J. McCreery, J. Lipid Res. 35, 763 (1994).
13. D. S. Goodman, D. Deykin, T. Shiratori, J. Biol. Chem. 239. 1335 (1964); G. M. Doolittle and T. Y. Chang, Biochemistry 21, 674 (1982).
14. D. S. Goodman, D. Deykin, T. Shiratori, J. Biol. Chem. 239. 1335 (1964); G. M. Doolittle and T. Y. Chang, Biochemistry 21, 674 (1982).
15. Transformation of yeast was performed with lithium acetate [H. Ito, Y. Fukuda, K. Murata, A. Kimura, J. Bacteriol. 153, 163 (1983)] by amino acid prototrophy selection. A diploid strain (5051) was constructed between two isogenic derivatives of W303 [B. J. Thomas and R. Rothstein, Cell 56, 619 (1989)]: W1346-3C(M4Ta, ade2-1, can1-100, his3-11, 15, leu2-3, 112, trp1-1, ura3-1) and W1134-2C (MATα., can1-100, his3-11, 15. leu2-3, 112, trp1-1, ura3-1, met14ΔHpal-Sall). Growth on complete [yeast extract, peptone, and dextrose (YPD)] or synthetic medium, sporulation, and dissection were performed as described [ F. Sherman and J. Hicks, Methods Enzymol. 194, 21 (1991)].
16. Transformation of yeast was performed with lithium acetate [H. Ito, Y. Fukuda, K. Murata, A. Kimura, J. Bacteriol. 153, 163 (1983)] by amino acid prototrophy selection. A diploid strain (5051) was constructed between two isogenic derivatives of W303 [B. J. Thomas and R. Rothstein, Cell 56, 619 (1989)]: W1346-3C(M4Ta, ade2-1, can1-100, his3-11, 15, leu2-3, 112, trp1-1, ura3-1) and W1134-2C (MATα., can1-100, his3-11, 15. leu2-3, 112, trp1-1, ura3-1, met14ΔHpal-Sall). Growth on complete [yeast extract, peptone, and dextrose (YPD)] or synthetic medium, sporulation, and dissection were performed as described [ F. Sherman and J. Hicks, Methods Enzymol. 194, 21 (1991)].
17. Transformation of yeast was performed with lithium acetate [H. Ito, Y. Fukuda, K. Murata, A. Kimura, J. Bacteriol. 153, 163 (1983)] by amino acid prototrophy selection. A diploid strain (5051) was constructed between two isogenic derivatives of W303 [B. J. Thomas and R. Rothstein, Cell 56, 619 (1989)]: W1346-3C(M4Ta, ade2-1, can1-100, his3-11, 15, leu2-3, 112, trp1-1, ura3-1) and W1134-2C (MATα., can1-100, his3-11, 15. leu2-3, 112, trp1-1, ura3-1, met14ΔHpal-Sall). Growth on complete [yeast extract, peptone, and dextrose (YPD)] or synthetic medium, sporulation, and dissection were performed as described [ F. Sherman and J. Hicks, Methods Enzymol. 194, 21 (1991)].
18. Competent cells of Escherichia coli strain DH5α (Gibco-BRL) and DNA-modfying enzymes (Promega) were used according to the manufacturer's instructions. The pH3(34) was digested with Nhe I, blunt-ended with Klenow, and digested with Avr II to liberate a 1614-bp fragment. An Xba I, Sma I fragment of pJH-H1 encoding the HIS3 gene was then inserted at these sites in the vector backbone to produce the are 1ΔNA allele. This construct was digested with Bsa I to liberate a 3821-bp fragment that was then transformed into strain 5051. Disruption of ARE1 was confirmed by Southern blot analysis.
19. H. Yang and S. L. Sturley, unpublished results.
20. 32PJdeoxycytidine triphosphate. Genomic DNA [C. S. Hoffman and F. Winston, Gene 57, 267 (1987)] was transferred to Hybond membranes (Amersham) and hybridized in the absence of formamide at 65° or 60°C [F. M. Ausubel et al., Current Protocols in Molecular Biology (Wiley, New York, 1987), vol. 1).
21. 32PJdeoxycytidine triphosphate. Genomic DNA [C. S. Hoffman and F. Winston, Gene 57, 267 (1987)] was transferred to Hybond membranes (Amersham) and hybridized in the absence of formamide at 65° or 60°C [F. M. Ausubel et al., Current Protocols in Molecular Biology (Wiley, New York, 1987), vol. 1).
22. A shotgun library of cosmid 14-21 from chromosome XIV (P. Philippsen, Biozentrum Basel) was constructed with the use of the nebulizing technique [C. M. Okpodu et al., Bio Techniques 16, 154 (1994)]. The DNA was nebulized (90 s, 2 bars), size-fractionated, treated with DNA polymerase I (Klenow fragment) and T4 DNA polymerase, and blunt-end ligated into pTZ18R(Pharmazia, Germany). Nucleotide sequencing was performed by dideoxy-chain termination with digoxigenin-labeled reverse primer and Sequenase (U.S. Biochemical). The reactions were analyzed on the GATC 1500 direct blotting electrophoresis system (GATC GmbH, Germany) with the use of the BoehringerMannheim Dig-development protocol. Sequences were aligned by SeqMan (DNA Star). Database searching was performed with BLAST [S. F. Altschul et al., J. Mol. Biol. 215, 403 (1990)] and GCG software [J. Devereux, P. Haeberli, O. Smithies, Nucleic Acids Res. 12, 387 (1984)]. The DNA sequences of the ARE1 and ARE2 genes are deposited at GenBank (P25628 and U51790, respectively).
23. A shotgun library of cosmid 14-21 from chromosome XIV (P. Philippsen, Biozentrum Basel) was constructed with the use of the nebulizing technique [C. M. Okpodu et al., Bio Techniques 16, 154 (1994)]. The DNA was nebulized (90 s, 2 bars), size-fractionated, treated with DNA polymerase I (Klenow fragment) and T4 DNA polymerase, and blunt-end ligated into pTZ18R(Pharmazia, Germany). Nucleotide sequencing was performed by dideoxy-chain termination with digoxigenin-labeled reverse primer and Sequenase (U.S. Biochemical). The reactions were analyzed on the GATC 1500 direct blotting electrophoresis system (GATC GmbH, Germany) with the use of the BoehringerMannheim Dig-development protocol. Sequences were aligned by SeqMan (DNA Star). Database searching was performed with BLAST [S. F. Altschul et al., J. Mol. Biol. 215, 403 (1990)] and GCG software [J. Devereux, P. Haeberli, O. Smithies, Nucleic Acids Res. 12, 387 (1984)]. The DNA sequences of the ARE1 and ARE2 genes are deposited at GenBank (P25628 and U51790, respectively).
24. A shotgun library of cosmid 14-21 from chromosome XIV (P. Philippsen, Biozentrum Basel) was constructed with the use of the nebulizing technique [C. M. Okpodu et al., Bio Techniques 16, 154 (1994)]. The DNA was nebulized (90 s, 2 bars), size-fractionated, treated with DNA polymerase I (Klenow fragment) and T4 DNA polymerase, and blunt-end ligated into pTZ18R(Pharmazia, Germany). Nucleotide sequencing was performed by dideoxy-chain termination with digoxigenin-labeled reverse primer and Sequenase (U.S. Biochemical). The reactions were analyzed on the GATC 1500 direct blotting electrophoresis system (GATC GmbH, Germany) with the use of the BoehringerMannheim Dig-development protocol. Sequences were aligned by SeqMan (DNA Star). Database searching was performed with BLAST [S. F. Altschul et al., J. Mol. Biol. 215, 403 (1990)] and GCG software [J. Devereux, P. Haeberli, O. Smithies, Nucleic Acids Res. 12, 387 (1984)]. The DNA sequences of the ARE1 and ARE2 genes are deposited at GenBank (P25628 and U51790, respectively).
25. KO-5′ and KO-3′ primers (GAGGGGACGAAAATTAGCCGCTATTAATTCTGGTATTGCCACCTAGACAAGAAGTAAACAGACACAGATGcaagagttc gaatctcttagc and CTATAAAGATTTAATAGCTCCACAGAACAGTTGCAGGATGCCTTAGGGTCGActacgtcgtaaggccgtttctgac, respectively; the lowercase lettering corresponds to the LEU2 gene) were used in a polymerase chain reaction (PCR) with the LEU2 gene as a template to produce the selectable yeast gene flanked by ARE2 gene sequences [A. Baudin, O, Ozier-Kalogeropoulos, A. Denouel, C. Cullin, Nucleic Acids Res. 21, 3329 (1993)]. This was used to transform a derivative of yeast strain 5051, heterozygous for the are 1ΔNA allele. To identify integrants at the ARE2 locus, we performed PCR on genomic DNA from these strains using are2-5′ (CATTGCAGTTACACGTGAATGC), are2-3′ (TAGCTCCACAGAACAGTTGCAGG), and a 3′ primer corresponding to the LEU2 gene (L2-3′: CTCTGACAACMCGAAGTCAG).
26. P. Greenspan, E. P. Mayer, S. D. Fowler, J. Cell Biol. 100, 965 (1985).
27. 14C]cholesterol internal standard and the dry weight of the cells.
28. S. L. Sturley, H. Yang, J. T, Billheimer, in preparation.
29. To overexpress the ARE1 gene by copy number under the control of its own promoter in YEp3-16, a 2354-bp Cla I fragment from pH3(34), encompassing the entire AREI gene, was blunt-ended with Klenow DNA polymerase I and introduced into the Sma I site of YEp352. To constitutively overexpress ARE1 from the ADH promoter in pADH5-36, a 2290-bp Nar I fragment of pH3(34), starting 70 bp 5′ to the ORF, was blunt-ended with Klenow and ligated to Klenow-treated, Eco Rl-digested pDC-ADH [a derivative of pS5; S. L. Sturley et al., J. Biol. Chem. 269, 21670 (1994)]. Increased expression of the ARE1 transcripts, relative to that in a wild-type cell, was confirmed by Northern blot analysis.
30. C. C. Chang et al., J. Biol. Chem. 270, 29532 (1995).
31. G. J. Warner et al., ibid., p. 5772.
32. 14C]acetate in 2 ml of defined media at 30°C for 3 hours and subjected to lipid saponification, hexane extraction, and thin-layer chromatography [R. Y. Hampton and J. Rine, J. Cell Biol. 125, 299 (1994)]. The incorporation of counts into total sterols was assessed after scintillation counting. To normalize the estimate of sterol biosynthesis to incorporation of acetate into the fatty acid pool, we acidified the aqueous lysate remaining after hexane extraction with concentrated HCI and re-extracted it with hexane [D. Dimster-Denk, M. K. Thorsness, J. Rine, Mol. Biol. Cell 5, 655 (1994)].
33. 14C]acetate in 2 ml of defined media at 30°C for 3 hours and subjected to lipid saponification, hexane extraction, and thin-layer chromatography [R. Y. Hampton and J. Rine, J. Cell Biol. 125, 299 (1994)]. The incorporation of counts into total sterols was assessed after scintillation counting. To normalize the estimate of sterol biosynthesis to incorporation of acetate into the fatty acid pool, we acidified the aqueous lysate remaining after hexane extraction with concentrated HCI and re-extracted it with hexane [D. Dimster-Denk, M. K. Thorsness, J. Rine, Mol. Biol. Cell 5, 655 (1994)].
34. I. Tabas, D. A. Weiland, A, R. Tall, J. Biol. Chem. 261, 3147 (1986).
35. M. Krieger and J. Herz, Annu. Rev. Biochem. 63, 601 (1994).
36. M. E. Basson, M. Thorsness, J. Rine, Proc. Natl. Acad. Sci. U.S.A. 83, 5563 (1986); S. L. Thompson. R. Burrows, R. J. Laub, S. K. Krisans, J. Biol. Chem. 262, 17420 (1987).
37. M. E. Basson, M. Thorsness, J. Rine, Proc. Natl. Acad. Sci. U.S.A. 83, 5563 (1986); S. L. Thompson. R. Burrows, R. J. Laub, S. K. Krisans, J. Biol. Chem. 262, 17420 (1987).
38. We gratefully acknowledge the assistance of I. Becker, W. H. Mewes, and A. Goffeau in screening the confidential data set obtained in the European sequencing project. We thank L A. Grivell and P. Philippsen for the provision of chromosome III DNA clones and the shotgun library of cosmid 14-21 from chromosome XIV, respectively. We thank A. Keesler and I. Tabas for helpful discussions, R. Golick for his assistance with confocal and fluorescence microscopy, N. Erdeniz for help with micromanipulations, and J. J. Rich, S. Gangloff, and A. Tinkelenberg for a critical reading of the manuscript. This work was supported in part by a Grantin-Aid/Investigatorship from the American Heart Association (New YorK City affiliate) and by the Ara Parseghian Medical Research Foundation to S.L.S., NIH grants GM50237 and HG00861 to R.R., R01 AI38598 to M.B., and HL40404 to R.J.D., and by the European Community within the framework of the BIOTECH program. M.B. acknowledges support from the Johnson and Johnson Focused Giving program.