Analysis of active site residues in Escherichia coli chorismate mutase by site-directed mutagenesis

Journal of the American Chemical Society

Volumn 118, Issue 7, 1996, Pages 1789-1790

  Liu, David R ^a   Cload, Sharon T ^a   Pastor, Richard M ^a   Schultz, Peter G ^a  

^a UNIVERSITY OF CALIFORNIA   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

CHORISMATE MUTASE;

ARTICLE; ENZYME ACTIVE SITE; ENZYME ACTIVITY; ESCHERICHIA COLI; SITE DIRECTED MUTAGENESIS;

EID: 0029897906     PISSN: 00027863     EISSN: None     Source Type: Journal    
DOI: 10.1021/ja953151o     Document Type: Article

References (29)

1. Chook, Y.-M.; Ke, H.; Lipscomb, W. H. Proc. Natl. Acad. Sci. U.S.A. 1993, 90, 8600.
2. Chook, Y.-M.; Gray, J. V.; Ke, H.; Lipscomb, W. N. J. Mol. Biol. 1994, 240, 476.
3. Lee, A. Y.; Karplus, P. A.; Ganem, B.; Clardy, J. J. Am. Chem. Soc. 1995, 117, 3627.
4. Lee, A. Y.; Stewart, J. D.; Clardy, J.; Ganem, B. Chem. Biol. 1995, 2, 195.
5. Haynes, M. R.; Stura, E. A.; Hilvert, D.; Wilson, I. A. Science 1994, 263, 646.
6. Gorisch, H. Biochemistry 1978, 17, 3700.
7. Addadi, L.; Jaffe, E. K.; Knowles, J. R. Biochemistry 1983, 22, 4494.
8. Copley, S. D.; Knowles, J. R. J. Am. Chem. Soc. 1987, 109, 5008.
9. Guilford, W. J., Copley, S D.; Knowles, J. R. J. Am. Chem. Soc. 1987, 109, 5013.
10. Bartlett, P. A., Nakagawa, Y., Johnson, C. R.; Riech, S. H.; Luis, A J Org. Chem. 1988, 53, 3195.
11. Delany, J. J.; Padykula, R. E.; Berchtold, G. A. J. Am. Chem. Soc. 1992, 114, 1394.
12. Gray, J. V ; Eren, D.; Knowles, J. R Biochemistry 1990, 29, 8872.
13. Gray, J. V.; Knowles, J. R. Biochemistry 1994, 33, 9953
14. Cload, S. T.; Liu, D. R., Pastor, R. M ; Schultz, P. G. J. Am. Chem. Soc. 1996, 118, 1787
15. 2): 5′ CTTGACCTGCATATGACATCGGAAAACCCGTTA 3′ (introducing a Ndel site upstream of the start codon); 5′ CAGGTCAAGAAGCTTT-TAGTGGTGGTGGTGGTGGTGGAGGATCGATCCGAGAAA 3′ (introducing a HindIII site downstream of the stop codon).
16. Stewart, J ; Wilson, D. B ; Ganem, B J Am. Chem Soc 1990, 112, 4582.
17. Doering, D S Thesis, Massachusetts Institute of Technology, 1992.
18. Kunkel Methods Enzymol, 1987, 154, 367.
19. Grodberg, J.; Dunn, J. J. J. Bacteriol. 1988, 170, 1245.
20. Hochuli, E.; Dobeli, H.; Schracher, A. J. Chromatogr. 1987, 411, 177.
21. CD spectra were taken at 25 °C in 10 mM Tris pH 7.8. 10% glycerol. 100 mM NaCl at a protein concentration of 30 μg/mL.
22. The assays were conducted as described in the preceding paper.
23. Impurities in the preparation were isolated by nickel affinity chromatography on the cell lysate of untransformed BL21 and possessed no mutase activity.
24. Burrows, C. J.; Carpenter, B. K. J. Am. Chem. Soc 1981, 103, 6983.
25. Burrows, C. J.; Carpenter, B. K. J. Am. Chem Soc 1981, 103, 6984.
26. Inverting the bound molecule of 3 in the active site such that the C10 and C11 carboxylates exchange places results in the loss of the two hydrogen bonds to O7 (and presumably the loss of turnover), but also in the possible formation of two new hydrogen bonds: the C4 hydroxyl may hydrogen bond with the side chain N of Gln 88 and with the hydroxyl of Ser 84. The C11 and C10 carboxylates exchange hydrogen-bonding partners in this orientation but maintain the number and geometry of these hydrogen bonds. Perhaps in the Glu52Asp and Glu52Ala mutants, the loss of the Glu 52-C4 hydroxyl hydrogen bond makes the inverted binding mode more attractive relative to the normal binding mode, leading to increased nonproductive binding.
27. Noren, C. J.; Anthony-Cahill, S. J.; Griffith, M. C.; Schultz, P. G. Science 1989, 244, 182.
28. Cornish, V. W.; Mendel, D.; Schultz, P. G. Angew. Chem., Int. Ed. Engl 1995, 34, 621.
29. Ellman, J.; Mendel, D.; Anthony-Cahill, S.; Noren, C J.; Schultz, P. G Methods Enzymol. 1991, 202, 301.