Purification and molecular cloning of Plx1, a Cdc25-regulatory kinase from Xenopus egg extracts

Science

Volumn 273, Issue 5280, 1996, Pages 1377-1380

  Kumagai, Akiko ^a   Dunphy, William G ^a  

^a CALIFORNIA INSTITUTE OF TECHNOLOGY   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

CYCLIN DEPENDENT KINASE;

AMINO TERMINAL SEQUENCE; ARTICLE; ENZYME ANALYSIS; ENZYME PHOSPHORYLATION; ENZYME PURIFICATION; MITOSIS; MOLECULAR CLONING; NONHUMAN; OOCYTE; PRIORITY JOURNAL; XENOPUS;

EID: 0029821131     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.273.5280.1377     Document Type: Article

References (43)

1. T, R. Coleman and W. G Dunphy, Curr. Opin. Cell Biol. 6, 877 (1994); W. G. Dunphy, Trends Cell Biol. 4, 202 (1994); R. W. King, P. K. Jackson, M. W. Kirschner, Cell 79, 563 (1994).
2. T, R. Coleman and W. G Dunphy, Curr. Opin. Cell Biol. 6, 877 (1994); W. G. Dunphy, Trends Cell Biol. 4, 202 (1994); R. W. King, P. K. Jackson, M. W. Kirschner, Cell 79, 563 (1994).
3. T, R. Coleman and W. G Dunphy, Curr. Opin. Cell Biol. 6, 877 (1994); W. G. Dunphy, Trends Cell Biol. 4, 202 (1994); R. W. King, P. K. Jackson, M. W. Kirschner, Cell 79, 563 (1994).
4. P. R. Mueller, T. R. Coleman, W. G. Dunphy, Mol. Biol. Cell 6,119 (1995); P. R. Mueller, T. R. Coleman, A. Kumagai, W, G. Dunphy, Science 270, 86 (1995).
5. P. R. Mueller, T. R. Coleman, W. G. Dunphy, Mol. Biol. Cell 6,119 (1995); P. R. Mueller, T. R. Coleman, A. Kumagai, W, G. Dunphy, Science 270, 86 (1995).
6. A. Kumagai and W. G. Dunphy, Cell 70, 139 (1992).
7. T. Izumi, D. H. Walker, J. L Maller, Mol. Biol. Cell 3, 927 (1992).
8. K. Galaktionov and D. Beach, Cell 67, 1181 (1991).
9. T. Izumi and J. L. Maller, Mol. Biol. Cell 6, 215 (1995).
10. A. Kumagai and W. G. Dunphy, unpublished results.
11. F. M. Davis, T. Y.Tsao, S. K. Fowler, P. N. Rao,Proc. Natl. Acad. Sci. U.S.A. 80, 2926 (1983); J. Kuang, C. L. Ashorn, M. Gonzalez-Kuyvenhoven, J. E. Penkala, Mol. Biol. Cell 5, 135 (1994).
12. F. M. Davis, T. Y.Tsao, S. K. Fowler, P. N. Rao,Proc. Natl. Acad. Sci. U.S.A. 80, 2926 (1983); J. Kuang, C. L. Ashorn, M. Gonzalez-Kuyvenhoven, J. E. Penkala, Mol. Biol. Cell 5, 135 (1994).
13. D. D. Vandre, F. M. Davis, P. N. Rao, G. G. Borisy, Proc. Natl. Acad. Sci. U.S.A. 81, 4439 (1984); D. D. Vandre, V. E. Centonze, J. Peloquin, R. M. Tombes, G. G. Borisy, J. Cell Sci. 98, 577 (1991); S. Taagepera, P. N. Rao, F. H. Drake, G. J. Gorbsky, Proc. Natl. Acad. Sci. U.S.A. 90, 8407 (1993); R. W. King et al., Cell 81, 279 (1995); X. S. Ye et al., EMBO J. 14, 986 (1995).
14. D. D. Vandre, F. M. Davis, P. N. Rao, G. G. Borisy, Proc. Natl. Acad. Sci. U.S.A. 81, 4439 (1984); D. D. Vandre, V. E. Centonze, J. Peloquin, R. M. Tombes, G. G. Borisy, J. Cell Sci. 98, 577 (1991); S. Taagepera, P. N. Rao, F. H. Drake, G. J. Gorbsky, Proc. Natl. Acad. Sci. U.S.A. 90, 8407 (1993); R. W. King et al., Cell 81, 279 (1995); X. S. Ye et al., EMBO J. 14, 986 (1995).
15. D. D. Vandre, F. M. Davis, P. N. Rao, G. G. Borisy, Proc. Natl. Acad. Sci. U.S.A. 81, 4439 (1984); D. D. Vandre, V. E. Centonze, J. Peloquin, R. M. Tombes, G. G. Borisy, J. Cell Sci. 98, 577 (1991); S. Taagepera, P. N. Rao, F. H. Drake, G. J. Gorbsky, Proc. Natl. Acad. Sci. U.S.A. 90, 8407 (1993); R. W. King et al., Cell 81, 279 (1995); X. S. Ye et al., EMBO J. 14, 986 (1995).
16. D. D. Vandre, F. M. Davis, P. N. Rao, G. G. Borisy, Proc. Natl. Acad. Sci. U.S.A. 81, 4439 (1984); D. D. Vandre, V. E. Centonze, J. Peloquin, R. M. Tombes, G. G. Borisy, J. Cell Sci. 98, 577 (1991); S. Taagepera, P. N. Rao, F. H. Drake, G. J. Gorbsky, Proc. Natl. Acad. Sci. U.S.A. 90, 8407 (1993); R. W. King et al., Cell 81, 279 (1995); X. S. Ye et al., EMBO J. 14, 986 (1995).
17. D. D. Vandre, F. M. Davis, P. N. Rao, G. G. Borisy, Proc. Natl. Acad. Sci. U.S.A. 81, 4439 (1984); D. D. Vandre, V. E. Centonze, J. Peloquin, R. M. Tombes, G. G. Borisy, J. Cell Sci. 98, 577 (1991); S. Taagepera, P. N. Rao, F. H. Drake, G. J. Gorbsky, Proc. Natl. Acad. Sci. U.S.A. 90, 8407 (1993); R. W. King et al., Cell 81, 279 (1995); X. S. Ye et al., EMBO J. 14, 986 (1995).
18. J. Kuang and C. L. Ashorn. J. Cell Biol. 4, 859 (1993); J. M. Westendorf, P. N. Rao, L. Gerace, Proc. Natl. Acad. Sci. U.S.A. 91, 714 (1994).
19. J. Kuang and C. L. Ashorn. J. Cell Biol. 4, 859 (1993); J. M. Westendorf, P. N. Rao, L. Gerace, Proc. Natl. Acad. Sci. U.S.A. 91, 714 (1994).
20. 2-terminal domain of Xcdc25, the procedure was similar except that oligonucleotides a and c (GAAGATCTTTAATTTAGAAGGGGTCCCG), which created a stop codon at amino acid 265. were used in the PCR reaction. The PCR fragments were ligated into pVL 1393-His6 (28). Recombinant baculoviruses were generated by standard procedures (Invitrogen), and proteins expressed in Sf9 insect cells were purified with nickel agarose (Pharmacia) (28).
21. M-phase extracts from cytostatic factor (CSF)-arrested Xenopus eggs were diluted with 2 volumes of extraction buffer (EB) (3) containing 1 mM phenylmethylsulfonyl fluoride (PMSF), pepstatin (10 μg/ml), chymostatin (10 μg/ml), and leupeptin (10 μg/ml) and centrifuged at 180,000g for 1 hour at 4°C. The supernatant was incubated for 1 hour at 4°C with one-sixth volume of nickel agarose containing 1 mg of His6-Xcdc25-N protein per milliliter of beads. The beads were washed once with buffer A [10 mM tris-HCI (pH 8.0), 10 μM phosphoserine, 10 μM phosphothreonine, 10 μM phosphotyrosine, 0.1 mM vanadate, and 0.1% CHAPS] containing 500 mM NaCl, 5 mM EGTA, 20 mM β-glycerolphosphate, and 1 μM microcystin. After three additional washes with the same buffer lacking microcystin, bound proteins were eluted from the column with buffer A containing 500 mM NaCl and 200 mM imidazole. The eluate was loaded on a Superdex 200 column equilibrated with buffer A containing 50 mM NaCl, 10 mM EGTA, and 10 mM EDTA. Column fractions containing Xcdc25-specific kinase activity were combined and incubated for 90 min at 4°C with a one-tenth volume of phosphocellulose P11 (Whatman, Hillsboro, OR) prepared as described [Y. Wang and P. J. Roach, in Protein Phosphorylation: A Practical Approach, D. Q. Hardie, Ed. (IRL Press, Oxford, 1993), pp. 121 -144]. The phosphocellulose was washed with 5 volumes of buffer A containing 50 mM NaCl. Bound proteins were eluted in buffer A containing 500 mM NaCl and 20 mM β-glycerolphosphate. The phosphocellulose eluate fraction was dialyzed against buffer A containing 25 mM NaCl and 20 mM β-glycerolphosphate and loaded onto a Mono Q PC 1.6/5 column (Pharmacia) equilibrated in the same buffer. The Mono Q column was eluted with a linear gradient up to 1 M (NaCl in the same buffer.
22. The Mono Q fractions containing kinase activity were pooled and loaded onto a 5 to 20% sucrose gradient in buffer A containing 20 mM β-glycerolphosphate. The gradient was centrifuged at 40,000 rpm for 16 hours in a Beckman SW55 rotor at 4°C. The fractions were collected and assayed for Xcdc25-specific kinase activity (29).
23. Proteins were separated by electrophoresis and blotted onto Problot (Applied Biosystems). p67 was excised and digested with sequencing-grade trypsin (Boehringer Mannheim) in the presence of hydrogenated Triton X-100 as described [J. Fernandez, L. Andrews, S. M. Mische, Anal. Biochem. 218, 112 (1994)]. The tryptic peptides were separated by reverse phase chromatography in an μRPC C2/C18 2.1/10 column with the use of the SMART system (Pharmacia). Peptide sequence analysis was performed with an ABI 476A sequencer (Applied Biosystems) in the Protein/Peptide Micro Analytical Facility at the California Institute of Technology.
24. Three degenerate primers corresponding to the peptide sequences KKXLX(T/G)TPNYIAPEVL, (A/S)GANTTP, and XX(D/I)APSTIDQ (30) were designed: p67-1, AA(A/G)AA(A/G)AA(T/C)(T/C)TITG(T/C)(G/A)(G/C)IACICC; p67-2, CCAIGGIGTIGT(A/G)TTIGCICC; and p67-3,GCICCI(A/T)(G/C)IA(C/T)IAT(T/C/A)GA(T/C)CA. X denotes an unreadable amino acid residue. PCR was done with Ampli Taq DNA polymerase (Perkin-Elmer), the p67-1 and p67-2 primers, and Xenopus oocyte cDNA for 35 cycles at 94°C for 1 min, 45°C for 2 min, and 72°C for 3 min. The reaction yielded a single 850-bp product. A PCR reaction with primer p67-3 indicated that the third peptide sequence was also encoded in the 850-bp fragment.
25. 32P-labeled deoxycytidine triphosphate by the random primer method. A Xho I-to-Xho I fragment from the cDNA containing the full coding sequence of Plx1 was subcloned into pBluescript SK (pBluescript-Plx1). Plasmids containing nested deletions of the cDNA generated by the Erase-a-base system (Promega Biotech) were sequenced with an ABI 373A automated DNA sequencer (Applied Biosystems).
26. R. M. Golsteyn et al., J. Cell Sci. 107, 1509 (1994): R. Hamanaka et al., Cell Growth Differ. 5, 249 (1994).
27. R. M. Golsteyn et al., J. Cell Sci. 107, 1509 (1994): R. Hamanaka et al., Cell Growth Differ. 5, 249 (1994).
28. S. Llamazares et al., Genes Dev. 5, 2153 (1991).
29. H. Ohkura, I. M. Hagan, D. M. Glover, ibid. 9, 1059 (1995).
30. K. Kitada, A. L. Johnson, L. H. Johnston, A. Sugino, Mol. Cell. Biol. 13, 4445 (1993).
31. An Nde I site was created at the initiation codon of Plx 1 in a PCR reaction containing Pfu DNA polymerase, pBluescript-Plx 1 (which contains an internal Nde I site), and the following oligonucleotides: p67-Nde-1, GGAATTCCATATGGCTCAAGTGGCCGG; and p67-Nde-2, CCTATTGACCATATGTCCACTTC. The Nde Ho-Eco Rl fragment of pBluescript-Plx1, encoding a COOH-terminal fragment of Plx1, was ligated into pVL 1393N-His (2). This procedure created pVL-His6-Plx-C. The PCR fragment was digested with Nde I and ligated into pVL-His6-Plx1-C to yield a baculovirus transfer plasmid encoding the full-length, histidine-tagged Plx1 protein.
32. The catalytically inactive N172A mutant of Plx 1 was created by PCR with the following oligonucleotides: P67-N172A-1, AACAGGGCCCCGAGCTTGAGGTCTCTGTG; and p67-N172A-2, TCGGGGCCCTGTTCCTTAATGATGAAATGGAGG.
33. 2 and stored at -8O°C.
34. W. J. Boyle, P. van der Geer, T. Hunter, Methods Enzymol 201, 110 (1991).
35. B. Fenton and D. M. Glover. Nature 363, 637 (1993); R. M. Golsteyn, K. E. Mundt, A. M. Fry, E, A. Nigg, J. Cell Biol. 129, 1617 (1995).
36. B. Fenton and D. M. Glover. Nature 363, 637 (1993); R. M. Golsteyn, K. E. Mundt, A. M. Fry, E, A. Nigg, J. Cell Biol. 129, 1617 (1995).
37. 15 by treatment with the Myt1 kinase as described (2).
38. R. Hamanaka et al., J. Biol. Chem. 270, 21086 (1995); K. S. Lee, Y. L. O. Yuan, R. Kuriyama, R. L. Erikson, Mol. Cell. Biol. 15, 7143 (1995).
39. R. Hamanaka et al., J. Biol. Chem. 270, 21086 (1995); K. S. Lee, Y. L. O. Yuan, R. Kuriyama, R. L. Erikson, Mol. Cell. Biol. 15, 7143 (1995).
40. A. Kumagai and W. G. Dunphy, Mol. Biol. Cell 6,199 (1995).
41. 32P as the standard.
42. Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C. Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
43. We thank members of the Dunphy lab for comments on the manuscript, P. R. Mueller for the Xenopus oocyte cDNA library, and D. S. Krapf and G. Hathaway for peptide sequencing. Supported in part by a grant from NIH. W.G.D. is an investigator of the Howard Hughes Medical Institute.