Two G protein oncogenes in human endocrine tumors

Science

Volumn 249, Issue 4969, 1990, Pages 655-658

  Lyons, John ^a   Landis, Claudia A ^b   Harsh, Griffith ^c   Vallar, Lucia ^f,g   Grünewald, Kurt ^h   Feichtinger, Hans ^h   Duh, Quan Yang ^d,e   Clark, Orlo H ^d,e   Kawasaki, Ernest ^a   Bourne, Henry R ^b   Mccormick, Frank ^a  

^a NOVARTIS PHARMA AG   (Switzerland)

^b Cardiovascular Research Institute ^*

^c Department of Neurosurgery ^*

^d VETERANS AFFAIRS MEDICAL CENTER   (United States)

^e UNIVERSITY OF CALIFORNIA   (United States)

^f CNR   (Italy)

^g UNIVERSITY OF MILAN   (Italy)

^h UNIVERSITY OF INNSBRUCK   (Austria)

Author keywords

[No Author keywords available]

Indexed keywords

GUANINE NUCLEOTIDE BINDING PROTEIN;

ADRENAL CORTEX TUMOR; ARTICLE; GENE MUTATION; HUMAN; HUMAN CELL; HYPOPHYSIS TUMOR; ONCOGENE; OVARY TUMOR; PRIORITY JOURNAL;

AMINO ACID SEQUENCE; BASE SEQUENCE; DNA, NEOPLASM; ENDOCRINE DISEASES; FEMALE; GTP PHOSPHOHYDROLASES; GTP-BINDING PROTEINS; HUMAN; MALE; MOLECULAR SEQUENCE DATA; MUTATION; NEOPLASMS; OLIGONUCLEOTIDE PROBES; ONCOGENES; PITUITARY NEOPLASMS; POLYMERASE CHAIN REACTION; SUPPORT, NON-U.S. GOV'T;

EID: 0025127424     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.2116665     Document Type: Article

References (55)

1. M. Barbacid, Annu. Rev. Biochem. 56, 779 (1987); J. L. Bos, Cancer Res. 49, 4682 (1989).
2. M. Barbacid, Annu. Rev. Biochem. 56, 779 (1987); J. L. Bos, Cancer Res. 49, 4682 (1989).
3. G. A. Landis et al., Nature 340, 692 (1989).
4. M. E. Abood, J. B. Hurley, M.-C. Pappone, H. R. Bourne, L. Stryer, J. Biol. Chem. 257, 10540 (1982); D. Cassel and Z. Selinger, Proc. Natl. Acad. Sci. U.S.A. 74, 3307 (1977); D. Cassel and T. Pfeuffer, ibid. 75, 2669 (1978); C. Van Dop, M. Tsubokawa, H. R. Bourne, J. Ramachandran, J. Biol. Chem. 259, 696 (1984).
5. M. E. Abood, J. B. Hurley, M.-C. Pappone, H. R. Bourne, L. Stryer, J. Biol. Chem. 257, 10540 (1982); D. Cassel and Z. Selinger, Proc. Natl. Acad. Sci. U.S.A. 74, 3307 (1977); D. Cassel and T. Pfeuffer, ibid. 75, 2669 (1978); C. Van Dop, M. Tsubokawa, H. R. Bourne, J. Ramachandran, J. Biol. Chem. 259, 696 (1984).
6. M. E. Abood, J. B. Hurley, M.-C. Pappone, H. R. Bourne, L. Stryer, J. Biol. Chem. 257, 10540 (1982); D. Cassel and Z. Selinger, Proc. Natl. Acad. Sci. U.S.A. 74, 3307 (1977); D. Cassel and T. Pfeuffer, ibid. 75, 2669 (1978); C. Van Dop, M. Tsubokawa, H. R. Bourne, J. Ramachandran, J. Biol. Chem. 259, 696 (1984).
7. M. E. Abood, J. B. Hurley, M.-C. Pappone, H. R. Bourne, L. Stryer, J. Biol. Chem. 257, 10540 (1982); D. Cassel and Z. Selinger, Proc. Natl. Acad. Sci. U.S.A. 74, 3307 (1977); D. Cassel and T. Pfeuffer, ibid. 75, 2669 (1978); C. Van Dop, M. Tsubokawa, H. R. Bourne, J. Ramachandran, J. Biol. Chem. 259, 696 (1984).
8. R. M. Burch, A. Luini, J. Axelrod, Proc. Natl. Acad. Sci. U.S.A. 83, 7201 (1986); T. M. Moriarty et al., J. Biol. Chem. 264, 13524 (1989); C. D. Smith, R. J. Uhing, R. Snyderman, ibid. 262, 6121 (1987); D. Julius, T. J. Livelli, T. M. Jessell, R. Axel, Science 244, 1057 (1989); A. Ashkenazi, E. G. Peralta, J. W. Winslow, J. Ramachandran, D. J. Capon, Cell 56, 487 (1989); A. Ashkenazi, J. Ramachandran, D. J. Capon, Nature 340, 146 (1989).
9. R. M. Burch, A. Luini, J. Axelrod, Proc. Natl. Acad. Sci. U.S.A. 83, 7201 (1986); T. M. Moriarty et al., J. Biol. Chem. 264, 13524 (1989); C. D. Smith, R. J. Uhing, R. Snyderman, ibid. 262, 6121 (1987); D. Julius, T. J. Livelli, T. M. Jessell, R. Axel, Science 244, 1057 (1989); A. Ashkenazi, E. G. Peralta, J. W. Winslow, J. Ramachandran, D. J. Capon, Cell 56, 487 (1989); A. Ashkenazi, J. Ramachandran, D. J. Capon, Nature 340, 146 (1989).
10. R. M. Burch, A. Luini, J. Axelrod, Proc. Natl. Acad. Sci. U.S.A. 83, 7201 (1986); T. M. Moriarty et al., J. Biol. Chem. 264, 13524 (1989); C. D. Smith, R. J. Uhing, R. Snyderman, ibid. 262, 6121 (1987); D. Julius, T. J. Livelli, T. M. Jessell, R. Axel, Science 244, 1057 (1989); A. Ashkenazi, E. G. Peralta, J. W. Winslow, J. Ramachandran, D. J. Capon, Cell 56, 487 (1989); A. Ashkenazi, J. Ramachandran, D. J. Capon, Nature 340, 146 (1989).
11. R. M. Burch, A. Luini, J. Axelrod, Proc. Natl. Acad. Sci. U.S.A. 83, 7201 (1986); T. M. Moriarty et al., J. Biol. Chem. 264, 13524 (1989); C. D. Smith, R. J. Uhing, R. Snyderman, ibid. 262, 6121 (1987); D. Julius, T. J. Livelli, T. M. Jessell, R. Axel, Science 244, 1057 (1989); A. Ashkenazi, E. G. Peralta, J. W. Winslow, J. Ramachandran, D. J. Capon, Cell 56, 487 (1989); A. Ashkenazi, J. Ramachandran, D. J. Capon, Nature 340, 146 (1989).
12. R. M. Burch, A. Luini, J. Axelrod, Proc. Natl. Acad. Sci. U.S.A. 83, 7201 (1986); T. M. Moriarty et al., J. Biol. Chem. 264, 13524 (1989); C. D. Smith, R. J. Uhing, R. Snyderman, ibid. 262, 6121 (1987); D. Julius, T. J. Livelli, T. M. Jessell, R. Axel, Science 244, 1057 (1989); A. Ashkenazi, E. G. Peralta, J. W. Winslow, J. Ramachandran, D. J. Capon, Cell 56, 487 (1989); A. Ashkenazi, J. Ramachandran, D. J. Capon, Nature 340, 146 (1989).
13. R. M. Burch, A. Luini, J. Axelrod, Proc. Natl. Acad. Sci. U.S.A. 83, 7201 (1986); T. M. Moriarty et al., J. Biol. Chem. 264, 13524 (1989); C. D. Smith, R. J. Uhing, R. Snyderman, ibid. 262, 6121 (1987); D. Julius, T. J. Livelli, T. M. Jessell, R. Axel, Science 244, 1057 (1989); A. Ashkenazi, E. G. Peralta, J. W. Winslow, J. Ramachandran, D. J. Capon, Cell 56, 487 (1989); A. Ashkenazi, J. Ramachandran, D. J. Capon, Nature 340, 146 (1989).
14. L. Vallar, A. Spada, G. Giannattasio, Nature 330, 566 (1987).
15. N. Billestrup, L. W. Swanson, W. Vale, Proc. Natl. Acad. Sci. U.S.A. 83, 6854 (1986).
16. H. K. W. Fong, K. K. Yoshimoto, P. Eversole-Cire, M. I. Simon, ibid. 85, 3066 (1988); M. Matsuoka, H. Itoh, T. Kozasa, Y. Kaziro, ibid., p. 5384.
17. H. K. W. Fong, K. K. Yoshimoto, P. Eversole-Cire, M. I. Simon, ibid. 85, 3066 (1988); M. Matsuoka, H. Itoh, T. Kozasa, Y. Kaziro, ibid., p. 5384.
18. M. Strathmann, T. M. Wilkie, M. I. Simon, Proc. Natl. Acad. Sci. U.S.A. 86, 7407 (1989).
19. M. Verlaan-de Vries et al., Gene 50, 313 (1986).
20. i2.
21. For direct sequencing of PCR product, a single band of appropriate size was excised from EtBr-stained agarose gel under ultraviolet (UV) light. The excised band was placed into a Costar spin-x 0.22-μm cellulose acetate filter unit, frozen at -70°C for 15 min, and centrifuged (Eppendorf microfuge) for 15 min at full speed. The DNA-containing eluate was transferred to a microcenrrifuge tube, 20 μg of glycogen was added, and DNA was precipitated with 0.2 volumes of 3 M sodium acetate and 0.3 volumes of isopropanol. DNA was sedimented (microcentrifuge), washed with 70% ethanol, dried at reduced pressure, and resuspended in 20 μl of double-distilled water. The sample was sequcnced according to the Sequenasc double-stranded protocol with 7.75 μl of DNA solution and 2.5 pmol of sequencing primer.
22. s allele. It is, therefore, not yet clear whether activating mutations in G protein α chains are truly dominant, or whether they require some reduction in expression of the wild-type gene to manifest their effects.
23. T. Kozasa, H. Itoh, T. Tsukamoro, Y. Kaziro, Proc. Natl. Acad. Sci. U.S.A. 85, 2081 (1988).
24. J. E. Dumonr, J. C. Jauniaux, P. P. Roger, Trends Biochem. Sci. 14, 67 (1989); P. Roger, M. Taton, J. Van Sande, J. E. Dumont, J. Clin. Endocrinol. Metab. 66, 1158 (1988).
25. J. E. Dumonr, J. C. Jauniaux, P. P. Roger, Trends Biochem. Sci. 14, 67 (1989); P. Roger, M. Taton, J. Van Sande, J. E. Dumont, J. Clin. Endocrinol. Metab. 66, 1158 (1988).
26. M. F. Dallman, W. C. Engeland, M. H. McBride, Ann. N.Y. Acad. Sci. 297, 373 (1977); M. F. Dallman, Endocrine Res, 10, 213 (1985).
27. M. F. Dallman, W. C. Engeland, M. H. McBride, Ann. N.Y. Acad. Sci. 297, 373 (1977); M. F. Dallman, Endocrine Res, 10, 213 (1985).
28. G. N. Gill, C. R. Ill, M. H. Simonian, Proc. Natl. Acad. Sci. U.S.A. 74, 5569 (1977); G. N. Gill, J. F. Crivello, P. J. Hornsby, M. H. Simonian, in Cold Spring Harbor Conferences an Cell Proliferation, G. H. Sato, A. B. Pardee, D. A. Sirbasku, Eds. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982), vol. 9, p. 461. These papers point out that an animal's temporary need - that is, over a few days or weeks - for increased secretion of a hormone may be more efficiently met by hypertrophy (that is, increase in size and secretory capacity of individual cells) than by hyperplasia (increase in cell number), perhaps because hypertrophy is more readily reversible than hyperplasia when the temporary need subsides.
29. G. N. Gill, C. R. Ill, M. H. Simonian, Proc. Natl. Acad. Sci. U.S.A. 74, 5569 (1977); G. N. Gill, J. F. Crivello, P. J. Hornsby, M. H. Simonian, in Cold Spring Harbor Conferences an Cell Proliferation, G. H. Sato, A. B. Pardee, D. A. Sirbasku, Eds. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982), vol. 9, p. 461. These papers point out that an animal's temporary need - that is, over a few days or weeks - for increased secretion of a hormone may be more efficiently met by hypertrophy (that is, increase in size and secretory capacity of individual cells) than by hyperplasia (increase in cell number), perhaps because hypertrophy is more readily reversible than hyperplasia when the temporary need subsides.
30. D. Gospodarowicz and F. Gospodarowicz, Endocrinology 96, 458 (1975).
31. A. G. Gilman, Annu. Rev. Biochem. 56, 615 (1987).
32. A. Yatani et al., Nature 336, 680 (1988).
33. T. Katada and M. Ui, Proc. Natl. Acad. Sci. U.S.A. 79, 3129 (1982).
34. E. J. van Corven, A. Groenink, K. Jalink, T. Eichholtz, W. H. Moolenar, Cell 59, 45 (1989); K. Seuwen, I. Magnaldo, J. Pouyssegur, Nature 335, 254 (1988).
35. E. J. van Corven, A. Groenink, K. Jalink, T. Eichholtz, W. H. Moolenar, Cell 59, 45 (1989); K. Seuwen, I. Magnaldo, J. Pouyssegur, Nature 335, 254 (1988).
36. D. Gospodarowicz, C. R. Ill, P. J. Hornsby, G. N. Gill, Endocrinology 100, 1080 (1977).
37. T. R. Jackson, L. A. C. Blair, J. Marshall, M. Goedert, M. R. Hanley, Nature 335, 437 (1988).
38. D. Gospodarowicz, C. R. Ill, C. R. Birdwell, Endocrinology 100, 1108 (1977).
39. S. S. Huang and J. S. Huang, J. Biol. Chem. 261, 9565 (1986); P. L. Lee et al., Science 245, 57 (1989).
40. S. S. Huang and J. S. Huang, J. Biol. Chem. 261, 9565 (1986); P. L. Lee et al., Science 245, 57 (1989).
41. H. Ushiro and S. Cohen, J. Biol. Chem. 255, 8363 (1980); T. Hunter and J. A. Cooper, Cell 24, 741 (1981); S. Cohen, H. Ushiro, C. Stoscheck, M. Chinkers, J. Biol. Chem. 257, 1523 (1982).
42. H. Ushiro and S. Cohen, J. Biol. Chem. 255, 8363 (1980); T. Hunter and J. A. Cooper, Cell 24, 741 (1981); S. Cohen, H. Ushiro, C. Stoscheck, M. Chinkers, J. Biol. Chem. 257, 1523 (1982).
43. H. Ushiro and S. Cohen, J. Biol. Chem. 255, 8363 (1980); T. Hunter and J. A. Cooper, Cell 24, 741 (1981); S. Cohen, H. Ushiro, C. Stoscheck, M. Chinkers, J. Biol. Chem. 257, 1523 (1982).
44. R. M. Johnson and J. C. Garrison, J. Biol. Chem. 262, 17285 (1987); S. B. Rodan, G. Wesolowski, K. Yoon, G. Rodan, ibid. 264, 19934 (1989); I. Teitelbaum, ibid. 265, 4218 (1990).
45. R. M. Johnson and J. C. Garrison, J. Biol. Chem. 262, 17285 (1987); S. B. Rodan, G. Wesolowski, K. Yoon, G. Rodan, ibid. 264, 19934 (1989); I. Teitelbaum, ibid. 265, 4218 (1990).
46. R. M. Johnson and J. C. Garrison, J. Biol. Chem. 262, 17285 (1987); S. B. Rodan, G. Wesolowski, K. Yoon, G. Rodan, ibid. 264, 19934 (1989); I. Teitelbaum, ibid. 265, 4218 (1990).
47. L. Brenner-Gati, K. A. Berg, M. C. Gershengorn, J. Clin. Invest. 82, 1144 (1988); J. S. Davis, L. L. Weakland, L. A. West, R. V. Farese, Biochem. J. 238, 597 (1986).
48. L. Brenner-Gati, K. A. Berg, M. C. Gershengorn, J. Clin. Invest. 82, 1144 (1988); J. S. Davis, L. L. Weakland, L. A. West, R. V. Farese, Biochem. J. 238, 597 (1986).
49. D. C. Medynski et al., Proc. Nail. Acad. Sci. U.S.A. 82, 4311 (1985).
50. M. Nakafuku, H. Itoh, S. Nakamura, Y. Kaziro, ibid. 84, 2140 (1987); C. Dietzel and J. Kurjan, Cell 50, 1001 (1987).
51. M. Nakafuku, H. Itoh, S. Nakamura, Y. Kaziro, ibid. 84, 2140 (1987); C. Dietzel and J. Kurjan, Cell 50, 1001 (1987).
52. M. Pupillo, A. Kumagai, G. S. Pitt, R. A. Firtel, P. N. Devreotes, Proc. Natl. Acad. Sci. U.S.A. 86, 4892 (1989).
53. For isolation of genomic DNA from paraffin-embedded tissue [D. K. Wright and M. M. Manos, in PCR Protocols: A Guide to Methods and Applications, M. Innis, D. Gelfand, J. Sninsky, T. White, Eds. (Academic Press, San Diego, 1990), pp. 153-158] three to five adjacent 5-μm sections were cut from paraffin blocks and mounted on glass slides. One slide was stained with hematoxylin and eosin and used as a guide to select a region on the other slides composed entirely of tumor. With a razor blade, excess paraffin and unwanted tissue were removed from the unstained slides, and the remaining tumor tissue was scraped into a sterile 1.5-ml microcentrifuge tube. To remove contaminating paraffin, the sample was incubated with 5 μl of octane (anhydrous, Aldrich) or Hemo-De (Fischer) at room temperature for 30 min with shaking. The tissue sample was ccntrifuged (5 min, 1000g), and the supernatant was discarded. The tissue sample was extracted twice with 500 μl of absolute ethanol and dried at reduced pressure. The tissue was treated with proteinase K (0.2 mg/ml) in 100 μl of digestion buffer (50 mM tris, pH 8.5, 1 mM EDTA, 0.5% Tween 20) at 37°C overnight, the digest was centrifuged to remove undigested debris, and the DNA-containing supernatant fraction was incubated at 95°C for 8 min.
54. i2 codon 205, GTGGGTGGTCAGCGGTCTGA (eight mutant codons tested).
55. We thank S. Phipps (Cetus) for technical assistance, C. Johnson (Cetus) for histologic analysis of paraffin-embedded tissue, H. Bos (University of Leiden) for reading the manuscript, R. Brescia (UCSF) for review of ovarian tumors and reading the manuscript, R. L. Davis (UCSF) for review of pituitary adenoma pathological slides, C. B. Wilson (UCSF) for providing pituitary tumor specimens, S. Masters for providing ovarian tumor specimens, A. Spada (University of Milan) for providing biochemically characterized pituitary samples, D. Spasic, L. Goda, and C. Levenson (Cetus) for synthetic oligonucleotides, and M. Dallman, D. Gospodarowicz, and R., Jaffe (UCSF) for advice. Supported in part by NIH grants (H.R.B. and C.A.L.) and grants from the Austrian Fonds Zur Forderung Der Wissenschaftlichen Forschung (K.G. and H.F.).