Porphyrin metalation catalyzed by a small RNA molcule

Journal of the American Chemical Society

Volumn 118, Issue 29, 1996, Pages 7012-7013

  Conn, M Morgan ^a   Prudent, James R ^a   Schultz, Peter G ^a  

^a UNIVERSITY OF CALIFORNIA   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

BIOCHEMISTRY; CATALYSIS; COPPER; MOLECULES; RNA;

METALATION; PORPHYRINS;

ORGANOMETALLICS;

PORPHYRIN; TRANSFER RNA;

ARTICLE; ENZYME ACTIVITY; ERYTHROPOIETIC PROTOPORPHYRIA; HEME SYNTHESIS; HUMAN; MICHAELIS MENTEN KINETICS; PHOTOSENSITIVITY; PORPHYRIN METABOLISM;

EID: 0008451711     PISSN: 00027863     EISSN: None     Source Type: Journal    
DOI: 10.1021/ja961249c     Document Type: Article

References (30)

1. Lavallee, D. K. Mol. Struct. Energ. 1988, 9, 279.
2. Berkow, R.; Fletcher, A. J. Merck Manual, 16th ed.; Merck & Co.: Rahway, NJ, 1992.
3. (a) Okuda, M.; Kohno, H.; Furukawa, T.; Tokunaga, R.; Taketani, S. Biochem. Biophys. Acta 1994. 1200, 123.
4. (b) Dailey, H. A.; Sellers, V, M.; Dailey, T. A. J. Biol. Chem. 1994, 269, 390.
5. Schultz, P. G.; Lerner, R. A. Science 1995, 269, 1815.
6. (a) Prudent, J. R.; Uno, T.; Schultz, P. G. Science 1994, 264, 1924.
7. (b) Prudent, J. R.; Staunton, J.; Schultz, P. G. J. Am. Chem. Soc. 1995, 117, 10145.
8. Lavallee, D. K.; Anderson, O. P. J. Am. Chem. Soc. 1982, 104, 4704.
9. Dailey, H. A.; Jones, C. S.; Karr, S. W. Biochem. Biophys. Acta 1989, 999, 7.
10. (a) Bain-Ackerman, M. J.; Lavalle, D. K. Inorg. Chem. 1979, 18, 3358.
11. (b) Funahashi, S.; Yamaguchi, Y.; Tanaka, M. Bull. Chem. Soc. Jpn. 1984, 57, 204.
12. Cochran, A. G.; Schultz, P. G. Science 1990, 249, 781.
13. (a) Tuerk, C.; Gold, L. Science 1990, 249, 505.
14. (b) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818.
15. Prudent, J. R. Ph.D. Thesis, University of California, Berkeley, 1995.
16. 50-GGCGCGCCTTCGGGAGC-3′) was converted to double-stranded DNA with AMV reverse transcriptase, PCR-amplified (64-fold) on a large scale (200 mL), and purified by phenol/chloroform extraction and ethanol precipitation. One twenty-fifth of this DNA was used for the initial runoff transcription with T7 RNA polymerase to yield 700 μg of RNA for the first round of selection.
17. Purchased from Porphyrin Products, Logan, UT, as a mixture of regioisomers.
18. Our initial studies have been carried out with Cu(II) rather than Fe(II) to avoid complications from product inhibition and aerobic sensitivity. Mesoporphyrin IX is less photosensitive and less prone to aggregation than protoporphyrin IX.
19. 3).
20. 2 and 1 μM primers (RT primer and GATAATACGATCACTATACCACGGCCCTTGCGGCCGC) for 8-15 cycles of 94 °C (30 s), 54 °C (30 s), and 74 °C (45 s). RNA was reannealed before selection by heating to 72 °C for 5 min in the absence of copper and then slowly cooling to room temperature before addition of copper.
21. (a) Milligan, J. F.; Uhlenbeck, O. C. Methods Enzymol. 1989, 180, 51.
22. (b) Ringquist, S.; Jones, T.; Snyder, E. E.; Gibson, T.; Boni, I.; Gold, L. Biochemistry 1995, 34, 3640.
23. DNA amplified by PCR was elongated with primers to introduce 5′-EcoRI and 3′-HindIII restriction sites. After restriction digestion, the library was ligated into pUCl118, transformed into Escherichia coli MC1061 by electroporation, and streaked onto agar plates. Plasmid DNA was isolated from overnight cultures using a Promega Wizard miniprep kit and sequenced using the M13 reverse primer with Sequenase 2.0. DNA suitable for runoff transcription was prepared by PCR of transformed colonies from an overnight culture (10 μL), followed by extraction with phenol/chloroform.
24. 559 = 20.9 mM-1), and the initial rate of reaction over 5 min was calculated by least-squares linear regression. The reaction shows a nonlinear dependence on the copper concentration from 1 to 10 mM. The maximum rate is observed at 3 mM. The complexity of porphyrin metalation rates resulting from multiple copper ion species has been previously reported: Funahashi, S.; Yamaguchi, Y.; Tanaka, M. Bull. Chem. Soc. Jpn. 1984, 57, 204-208.
25. RNA pools from previous rounds were assayed for activity and found to be inactive.
26. -1.
27. 2 (100 mM) and N-methylmesoporphyrin (5 mM in DMSO) were mixed in equimolar amounts and allowed to stand in the dark for 18 h and then diluted to 1.0 mM. The red-brown NMMP turns green upon Cu(II) chelation.
28. i of the five curves was taken.
29. It is known that the four N-methylmesoporphyrin regioisomers inhibit ferrochelatase to different degrees: De Matteis, F.; Gibbs, A. H.; Harvey, C. Biochem. J. 1985, 226, 537.
30. Zucker, M.; Jaeger, J. A.; Turner, D. H. Nucleic Acids Res. 1991, 19, 2707.